ID: 1153805717

View in Genome Browser
Species Human (GRCh38)
Location 18:8706714-8706736
Sequence GTGAGCCGCGCCTCGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153805717 Original CRISPR GTGAGCCGCGCCTCGGCCGC AGG Intronic
900088041 1:907973-907995 GTGAGCCTCGCCTTGGCCAGAGG - Intergenic
904941006 1:34164865-34164887 GTGGGGCGCGCGGCGGCCGCTGG + Intronic
905174102 1:36125419-36125441 CTGACCCGCGGCTCGGCCGCCGG + Intergenic
905639000 1:39576033-39576055 GTGAGCCGCGGCGCGGGCCCGGG - Exonic
905847131 1:41242276-41242298 GTGGCGCGCGCCTCGGCCGTTGG + Intergenic
906167132 1:43694796-43694818 GTGAGCTGCGCCCAGGCTGCCGG + Exonic
914808367 1:151008399-151008421 TAGAGCCCCGCCTCCGCCGCTGG + Intronic
1063242783 10:4188367-4188389 GTGAGCCTCGCCACGGGAGCGGG + Intergenic
1065186479 10:23174429-23174451 GTGGGCTGGGCGTCGGCCGCGGG + Intergenic
1067479436 10:46585400-46585422 CGGAGCCCCGCCTGGGCCGCAGG + Intronic
1067615302 10:47756398-47756420 CGGAGCCCCGCCTGGGCCGCAGG - Intergenic
1069486646 10:68827896-68827918 GGAAGCCGCGCGGCGGCCGCAGG - Exonic
1069486733 10:68828232-68828254 GGAAGCCGCGCGGCGGCCGCAGG - Intronic
1071630703 10:87216349-87216371 CGGAGCCCCGCCTGGGCCGCAGG - Intergenic
1075885420 10:125896009-125896031 GGGAGCCGCGCCTCAGCGGGAGG - Intronic
1076819065 10:132929658-132929680 GTGAGCAGCGCCTCATCCCCAGG + Intronic
1078801061 11:14644273-14644295 GGGAGCAGCGCCGCGGCTGCTGG - Exonic
1081710000 11:45210349-45210371 GGGACACCCGCCTCGGCCGCTGG - Intronic
1083936592 11:65872814-65872836 GTGGGCCGCGCCGCGGCAGGCGG - Exonic
1084273031 11:68039085-68039107 GCGCGCCGCGCCTCCGCTGCTGG - Exonic
1084372222 11:68751466-68751488 GTGGGCCGGGCCTCAGGCGCAGG + Exonic
1090305247 11:125685780-125685802 GTTAGCCGCCTCTCGGGCGCTGG + Intergenic
1090345015 11:126062735-126062757 GGGAGCGGCGCCTCGCACGCCGG + Intronic
1090616794 11:128522373-128522395 CGGCGCCGCGTCTCGGCCGCTGG + Intronic
1104929195 12:132329355-132329377 GCGCGCCGGGCCACGGCCGCCGG + Intergenic
1114659262 14:24334471-24334493 GTGAGCCGAGCCTCTGCTGCGGG - Intronic
1116887104 14:50231912-50231934 GCGGGCCGAGCCTCGGCTGCTGG - Intergenic
1117813762 14:59576596-59576618 GTAAGACGCCCCTCGGGCGCTGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122540213 14:102493773-102493795 GGGAGCCGCGCCTGTGCTGCAGG - Intronic
1122558493 14:102593641-102593663 GTGAGCTGCGCCTCGGCCAGGGG + Intronic
1127117582 15:55743186-55743208 GTGGACAGCGCCGCGGCCGCGGG + Intergenic
1129387099 15:75202177-75202199 GGGAGCCGCGCCTGGGCCGAGGG + Intronic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1135382731 16:22008123-22008145 GCGGGCCGCGCCGCGGCTGCTGG + Intronic
1136779105 16:32885961-32885983 GTGAGCCGGGCAGCCGCCGCGGG - Intergenic
1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG + Intergenic
1139364827 16:66427040-66427062 GGGAGCCGCGCCGCCGCCGAGGG + Intergenic
1141280651 16:82627557-82627579 CCGAGCAGCGCTTCGGCCGCTGG - Intronic
1203081520 16_KI270728v1_random:1148049-1148071 GTGAGCCGGGCAGCCGCCGCGGG - Intergenic
1142863499 17:2777166-2777188 GTGTGCAGCGCCCCGCCCGCGGG - Intronic
1143106613 17:4533462-4533484 GGGAGCTGGGCCTGGGCCGCGGG + Intronic
1144656991 17:17043008-17043030 GGGAGCCGCGGGTCGGCGGCCGG + Intronic
1146371172 17:32266262-32266284 GGCAGCCGCTCCTCGGCCTCGGG - Exonic
1147159459 17:38561919-38561941 CTGAGCCTGGCCGCGGCCGCCGG - Exonic
1147971037 17:44219240-44219262 CTGAGCCGAGCCCCGGCCGCTGG - Intronic
1148141724 17:45333809-45333831 GTGAGCCTGGCCTGGGCTGCAGG + Intergenic
1148183145 17:45620798-45620820 GCGAGCCGGGCAGCGGCCGCGGG + Intergenic
1148265705 17:46224893-46224915 GCGAGCCGGGCAACGGCCGCGGG - Intronic
1152362431 17:79838963-79838985 GAGCCCCGCGCCTCGGCCCCCGG + Intronic
1152406624 17:80101626-80101648 GTGAGCCGGGCCGGGGCTGCGGG + Intergenic
1153805717 18:8706714-8706736 GTGAGCCGCGCCTCGGCCGCAGG + Intronic
1160163166 18:76491163-76491185 CTCCGCCGCGCCTCGGCCCCCGG + Intronic
1160784047 19:891608-891630 CTCAGCCCCGCCTCGGCCACAGG - Intronic
1160784067 19:891681-891703 CTCAGCCCCGCCTCGGCCACAGG - Intronic
1160784077 19:891718-891740 GTCAGCCCCGCCTCGGCCACAGG - Intronic
1160784097 19:891791-891813 CTCAGCCCCGCCTCGGCCACAGG - Intronic
1160784107 19:891828-891850 CTCAGCCCCGCCTCGGCCACAGG - Intronic
1160784128 19:891903-891925 CTCAGCCCCGCCTCGGCCACAGG - Intronic
1160784149 19:891978-892000 CTCAGCCCCGCCTCGGCCACAGG - Intronic
1160784159 19:892015-892037 CTCAGCCCCGCCTCGGCCACAGG - Intronic
1160864331 19:1250366-1250388 ATGGGCGCCGCCTCGGCCGCCGG - Exonic
1161089153 19:2351687-2351709 CTGAGCCCCGTCGCGGCCGCAGG - Intronic
1161101869 19:2425494-2425516 GTGAGCCCCGCCCCGGCCCAGGG + Intronic
1163760665 19:19134761-19134783 GTGAGCCCCGCCCCGGCGGTGGG - Intronic
1167019066 19:46861006-46861028 GAGAGCCGCGGCGCGGCGGCAGG + Intergenic
926035269 2:9631026-9631048 GTGGACCGCCCCTCGGCCCCGGG - Intergenic
935255718 2:101308265-101308287 GGGCGCGGCCCCTCGGCCGCCGG + Exonic
937993077 2:127674942-127674964 GCGAGCTGCGCCTCGGCCAGGGG + Intronic
942446209 2:176080477-176080499 TTGAGCCCCGCGGCGGCCGCGGG + Exonic
942565906 2:177264624-177264646 CCGCGCCGCGCCTCGGCAGCCGG - Exonic
943033845 2:182716348-182716370 GTGCGCCGCGGCTGGGCCGTCGG + Exonic
949004291 2:241636828-241636850 GGGCGCCGGGCCTCGGCGGCCGG - Intronic
1170562674 20:17570296-17570318 GTGAGCCGTGCCTCAGCCCGGGG + Intronic
1170674530 20:18467043-18467065 GCGAGCCGCGCCCCGCCCACTGG + Exonic
1170924685 20:20712352-20712374 GTGAGGCGCGCGCCGGGCGCGGG - Intronic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1178680521 21:34669593-34669615 GTGCCCCGCGCCTCGGCCTCCGG - Exonic
1185314003 22:50170963-50170985 GCGCCCCGCGCCCCGGCCGCCGG - Intronic
1185337608 22:50277761-50277783 GAGAGCCGGGGCTGGGCCGCGGG + Intronic
958641544 3:96813533-96813555 GTGGCCCGCGCCTCGGCTTCCGG + Intergenic
963038435 3:141051596-141051618 ACGGGCCGCGCCTCGGCCGCTGG - Exonic
968623693 4:1616273-1616295 GTGAGCCGCTCCTGGGCTCCTGG - Intergenic
972586210 4:40438844-40438866 ATGAGCAGTGACTCGGCCGCCGG - Exonic
973551271 4:52038200-52038222 GTGAGTACCGCCGCGGCCGCGGG - Intronic
982736919 4:159016764-159016786 GTGAGCCGCAGCTGGGCCACTGG + Intronic
986449217 5:7849917-7849939 GGGAGCCGCGCCCAGCCCGCTGG + Intronic
986738200 5:10682911-10682933 GTGAGCCAGGCCTGGGACGCTGG + Intronic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
991707237 5:69369627-69369649 GTGGGCCGCGGCTGGGCCGCCGG - Intronic
992663542 5:78984703-78984725 CGGACCCGCGCCCCGGCCGCCGG - Intronic
992690559 5:79236803-79236825 GGGAGCCGCTCCTCTGCCTCTGG - Exonic
993651762 5:90529956-90529978 CTGAGCCACGCCTCGTCCTCAGG - Intronic
995632174 5:114145830-114145852 GTGAGCCGGACCTGGACCGCTGG + Intergenic
998583615 5:143404195-143404217 GTGGCCCGCGCCGCCGCCGCCGG + Intronic
999328229 5:150656599-150656621 GGGGGCCGCGCCTCGGTCTCAGG - Intronic
1014272490 6:119349659-119349681 CTGAGCCGCGCCGGGGCTGCGGG - Exonic
1015799195 6:137044202-137044224 GGATGCCGCGTCTCGGCCGCCGG - Intronic
1016714097 6:147204076-147204098 GCGAGCAGCGGCGCGGCCGCGGG + Intergenic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1018419690 6:163630922-163630944 GGGGGCCGCGCCTCGCCCCCAGG - Intergenic
1019112009 6:169724211-169724233 GTGAGAAGCGCCGCCGCCGCTGG - Intronic
1019119451 6:169791749-169791771 GTGAGTCAGGCCTCGGCTGCAGG + Intergenic
1019343963 7:520687-520709 CTGAGCTGCGCCTCGGCCGGAGG - Intergenic
1019421676 7:953895-953917 GTGAGCGGCGCCCCTGCCCCCGG - Intronic
1020418226 7:7969495-7969517 GTGGGCTGCGCCCCGGCTGCGGG + Exonic
1024993510 7:55254476-55254498 GAGAGCCGCGCTGGGGCCGCAGG - Intronic
1050537789 9:6645455-6645477 GGGGGCTGCGCCTGGGCCGCGGG - Exonic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1197774423 X:130110392-130110414 GGGACCCGCGTCTCGGCCCCCGG - Exonic