ID: 1153806461

View in Genome Browser
Species Human (GRCh38)
Location 18:8712435-8712457
Sequence CAGTGTGGCCTGGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 4, 3: 85, 4: 640}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153806451_1153806461 -6 Left 1153806451 18:8712418-8712440 CCCAGATGCCGGGTGCTCAGTGT 0: 1
1: 0
2: 0
3: 12
4: 85
Right 1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG 0: 1
1: 0
2: 4
3: 85
4: 640
1153806446_1153806461 24 Left 1153806446 18:8712388-8712410 CCTGGTTTTTGACATTTGGCAGC 0: 1
1: 0
2: 1
3: 25
4: 174
Right 1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG 0: 1
1: 0
2: 4
3: 85
4: 640
1153806443_1153806461 30 Left 1153806443 18:8712382-8712404 CCCTGACCTGGTTTTTGACATTT 0: 1
1: 0
2: 1
3: 28
4: 337
Right 1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG 0: 1
1: 0
2: 4
3: 85
4: 640
1153806452_1153806461 -7 Left 1153806452 18:8712419-8712441 CCAGATGCCGGGTGCTCAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 135
Right 1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG 0: 1
1: 0
2: 4
3: 85
4: 640
1153806444_1153806461 29 Left 1153806444 18:8712383-8712405 CCTGACCTGGTTTTTGACATTTG 0: 1
1: 0
2: 0
3: 18
4: 240
Right 1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG 0: 1
1: 0
2: 4
3: 85
4: 640

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153806461 Original CRISPR CAGTGTGGCCTGGGGGTGGA GGG Intronic
900191995 1:1355875-1355897 CAGAGGGCCCTGGTGGTGGAGGG + Intronic
900274151 1:1812640-1812662 CAGTGAGGCCTGTGGGAGGCTGG - Intronic
900299593 1:1970069-1970091 CAGTGGGGCCCGTGGGTGGGGGG + Intronic
900396996 1:2457136-2457158 CAGGATGGCCTGGGGCTGGGGGG + Intronic
901509219 1:9707519-9707541 CACGGGGGCCTGAGGGTGGAGGG - Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
901883055 1:12205162-12205184 GAGGGAGGCCAGGGGGTGGAGGG + Intronic
902042973 1:13505880-13505902 TGGTGTGGCCTGGGTGGGGAAGG + Intronic
902985098 1:20150112-20150134 CAGTGTGGCATGGGGGGTGGGGG - Exonic
902990693 1:20185560-20185582 CAGTGTGGCCCCGGAGTGGGAGG + Intergenic
903323631 1:22556828-22556850 CAGTGTGGCTAGCGGCTGGAAGG + Intergenic
904530347 1:31164544-31164566 CAGCTTGGGCTGGGGGTGGAGGG - Intergenic
904592300 1:31621628-31621650 CTGTGTGGGCTGGGGGTGGGAGG + Intronic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905321290 1:37119244-37119266 GATTGTTGCCTGGGGATGGAGGG + Intergenic
905677026 1:39833824-39833846 TGGTGTTGGCTGGGGGTGGAGGG - Intergenic
905706187 1:40060668-40060690 GAGTGTGGGGTGGGGGTGGGGGG - Intronic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
906125072 1:43422697-43422719 CAGTGAGGTCTGGGGTTAGAGGG - Intronic
906193717 1:43915549-43915571 CAGTTCTGCCTTGGGGTGGAGGG + Intronic
907323557 1:53620668-53620690 CAAGGAGGGCTGGGGGTGGAAGG + Intronic
907351197 1:53832769-53832791 CAGTGTGGGCTGGGCATGGGGGG + Intronic
907447751 1:54519877-54519899 CAGTCAGGCCTGGGGGTGGCAGG - Intergenic
907470529 1:54670796-54670818 CAGGGTGGGCTGGGTGTGGCTGG - Exonic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
909508145 1:76418367-76418389 CAGTGTAGCTTGAAGGTGGAGGG + Intronic
909659059 1:78062317-78062339 CAGTGTGTTCTGGGTGTGGTTGG + Intronic
910827166 1:91421604-91421626 CAATCTGGGCTGGGGGTGGGGGG - Intergenic
911026468 1:93440728-93440750 CAGTGAGGCCTGGGCGTTGTTGG + Intergenic
911607603 1:99926209-99926231 CAGTGGGTCCTGTGGGTTGATGG - Intergenic
913173731 1:116255480-116255502 AAGTGTGGCTGGGGGGTGGGGGG - Intergenic
914424520 1:147562763-147562785 GAGTGTGGACGGGGGGTGGCAGG + Intronic
914753367 1:150550075-150550097 CAGGGAGACCTGGGGGTGAAGGG + Intronic
914758339 1:150579313-150579335 GAGTCTGGCGTGAGGGTGGACGG + Exonic
915053582 1:153103571-153103593 CATTGTGGCTTGGGGCTGTAGGG - Intronic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
916166544 1:161971229-161971251 CAGTGTGCCCTGGGAGTGGGCGG + Intergenic
916571178 1:166029102-166029124 CAGTGGGGCAGCGGGGTGGAGGG + Intergenic
918619909 1:186591307-186591329 CAATGTGTCTTGGGGATGGATGG - Intergenic
919147516 1:193654792-193654814 CAGTGTGGTCTGTGGTTGGTAGG + Intergenic
919150404 1:193690030-193690052 CAGGGTGGGAAGGGGGTGGATGG + Intergenic
919649185 1:200128693-200128715 CAGGGTGGAGTGGGGGTGGTGGG + Intronic
919689373 1:200515519-200515541 CATTGTTCCCTGTGGGTGGATGG - Intergenic
920284332 1:204868779-204868801 CTGGGTGGCCTGGGGGTTGGAGG - Intronic
920297776 1:204969523-204969545 CTGTTTGGCCTGGGGCTGTATGG + Intronic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920676927 1:208044511-208044533 CCGTGTGGCCTTGGAGTGCAAGG - Exonic
921671356 1:217927310-217927332 CAGTGTGTCCTGGGAGTGGTAGG + Intergenic
922248247 1:223821511-223821533 AGGTGTGGACTGGGGGTTGAGGG + Intronic
922315193 1:224435126-224435148 CAGTGTGGCATGGGCATGTAAGG + Intronic
922419911 1:225452417-225452439 GAATGTGTCCTGGGGCTGGAAGG - Intergenic
922553987 1:226519229-226519251 CAGTGTGGCTTTGTGGTTGAGGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923214837 1:231839119-231839141 CACCGTGGCTTGGGGATGGAAGG + Intronic
923566856 1:235082933-235082955 CAGTGGGGGGTGGGGGTGGCTGG - Intergenic
1063361895 10:5466306-5466328 CAGACTTGCCTGGGGGAGGAGGG - Intergenic
1063489327 10:6448383-6448405 CAGTGTGGCCTGGCCAGGGAAGG + Intronic
1063822832 10:9856772-9856794 CAGGGTGGCCTTGGAGTAGAAGG - Intergenic
1064170455 10:13027555-13027577 CACTGTGCCCTGGGCGTGGATGG - Intronic
1064188142 10:13181510-13181532 CACTGGGGCCTGTTGGTGGAGGG + Intronic
1064931590 10:20634453-20634475 CAAAGCAGCCTGGGGGTGGAAGG + Intergenic
1066069480 10:31792220-31792242 CACTGGGGCCTGAGGGTAGAGGG - Intergenic
1066094213 10:32056886-32056908 CATTTTTGTCTGGGGGTGGAGGG + Intergenic
1066746213 10:38605370-38605392 CCGTGTGGCCAGGTGGTGGCTGG - Intergenic
1067684235 10:48457479-48457501 CTGGGAGGCCTAGGGGTGGAGGG - Intronic
1067790194 10:49281935-49281957 CAATGTATCCTGGAGGTGGAGGG - Intergenic
1068259251 10:54556858-54556880 CTGTGTGCCCTGGGAGTGGCAGG + Intronic
1068493052 10:57748419-57748441 CACTGGGGCCTGTTGGTGGATGG - Intergenic
1069151718 10:64969773-64969795 CACTGGGGCCTGTGGGTGGGTGG + Intergenic
1070150090 10:73800160-73800182 CAGTGTGGCCTGTGAGTTGTGGG + Exonic
1070592404 10:77810488-77810510 CAGCCTGGCCTGGGGCTGCAGGG - Intronic
1070850145 10:79556866-79556888 CAGTGAGGCCTTGGGGTAGAAGG - Exonic
1070854392 10:79594946-79594968 CAGTGAGGTCTTGGGGTAGAAGG - Intergenic
1070857077 10:79614434-79614456 CAGTGAGGTCTTGGGGTAGAAGG + Exonic
1071297426 10:84232451-84232473 CAGCGTGTCCTTGGTGTGGAAGG - Exonic
1071944919 10:90633679-90633701 CAGTCTGGCTTATGGGTGGAAGG - Intergenic
1072224770 10:93358784-93358806 CACTGGGGCCGGCGGGTGGAGGG + Intronic
1072593044 10:96844900-96844922 AAGTGTGGGGTGGTGGTGGAGGG + Intronic
1072626716 10:97116818-97116840 CATGGTGGGCTGGGGATGGAGGG - Intronic
1072687081 10:97543912-97543934 CGGTGGGGCCTGGTGCTGGATGG + Intronic
1073202672 10:101749050-101749072 CACTGAGGCCTGGGGAAGGACGG - Intergenic
1073432388 10:103494602-103494624 TGGAGTGGGCTGGGGGTGGAGGG + Intronic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1075015643 10:118908445-118908467 CAGTGGGGGCTGGGGGAGGGAGG - Intergenic
1075079106 10:119370962-119370984 GAGTGGGGCGGGGGGGTGGAAGG - Intronic
1075378281 10:121997286-121997308 CATTCTGGTCTGAGGGTGGATGG + Intronic
1075411172 10:122229087-122229109 GAGGGTGGCGTGGGGGTGGGAGG + Intronic
1075641050 10:124064825-124064847 CAGTGTGGTCTGGGGTTTCAGGG - Intronic
1075723813 10:124601756-124601778 CAGTGGGGCCTGGCGGGGAAGGG - Intronic
1076562158 10:131374034-131374056 CAGTGGGGCCTGGGCAGGGAGGG - Intergenic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1077010405 11:376859-376881 CTGTGTGGCCTGGGGGCCGCCGG - Exonic
1077153669 11:1082183-1082205 CAGTGGTGCCTGCGGGTGGGAGG + Intergenic
1077407006 11:2387142-2387164 CAGGGAGGGCTGGGGGTGGATGG + Intronic
1077426597 11:2482643-2482665 CAGTGTGGGGTGGGGGTTGGCGG - Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1078107780 11:8369536-8369558 CAGTGGGGCCTGGGGAGGGAGGG + Intergenic
1078181804 11:9017922-9017944 CAGCCTGGCCGGTGGGTGGAGGG + Intergenic
1078328291 11:10398100-10398122 CAGTGTGGATTTGGAGTGGAAGG + Intronic
1078429566 11:11278349-11278371 CAGTGGGGCCTGTTGGTGGGTGG + Intronic
1078846106 11:15119634-15119656 AAATGTGGCCTGTGGTTGGAGGG + Intronic
1078854736 11:15197802-15197824 GTGTGTGGGCTGGTGGTGGAAGG - Intronic
1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG + Intergenic
1079453609 11:20618566-20618588 CACTGTGGCCTGAGGTTCGATGG - Intronic
1081870400 11:46380467-46380489 CTGTGCGGCCTGGGGGTGGGGGG + Exonic
1082204380 11:49414668-49414690 CAGTGTGGCTTGTGGGTAGGAGG - Intergenic
1083155761 11:60821966-60821988 CTGCAGGGCCTGGGGGTGGAGGG - Intergenic
1083663712 11:64263792-64263814 CAGGGTGAGCTGGGGGTGGGCGG + Exonic
1083680345 11:64348850-64348872 CAGTGGGGGCTGGGGGGGCAGGG - Intronic
1083930027 11:65836884-65836906 CACTGTGGCCTGTGGGGGGCTGG + Intronic
1084112746 11:67024107-67024129 GAGCCTGGCCTGTGGGTGGAAGG + Intronic
1084114342 11:67033145-67033167 CAGAGTGGCCGGGGGAGGGAGGG - Intronic
1084289464 11:68152537-68152559 CACTGAGGCCTGGGGGCGGCAGG - Intergenic
1084630616 11:70346185-70346207 CAGTGTGACCAGGGGGTGCCTGG + Intronic
1084641929 11:70431372-70431394 CAGTGTGGCGTGGGTGTAGAGGG + Intronic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1085283206 11:75344241-75344263 GAGTGTGTCCTGGGTGGGGATGG - Intronic
1085332711 11:75667341-75667363 GGGTGTGGCCTGGGACTGGAGGG + Intronic
1085987930 11:81807866-81807888 TAGTTTGGCCTGGCGATGGAGGG - Intergenic
1086349429 11:85930753-85930775 CACTGTGGCCTGTCGGTGGGTGG + Intergenic
1087007441 11:93483510-93483532 GAGAGAGGCCTGGGGGTGGAGGG + Intronic
1087018189 11:93574955-93574977 CACAGGGGCCTGGTGGTGGAGGG + Intergenic
1087044157 11:93830364-93830386 CAGGGTGGCCAGGGGATGCAGGG - Intronic
1087499146 11:98929190-98929212 CAATGGGGGCTGGGGGTGGTGGG - Intergenic
1088313468 11:108484350-108484372 CATTGTGGGCTGGTGGTGGAGGG + Intronic
1088464813 11:110123948-110123970 CAGCATGGCCTGGGACTGGATGG - Intronic
1088595528 11:111437727-111437749 GAGTGTCGCCTAGGAGTGGAGGG - Intronic
1088738370 11:112746984-112747006 CAGTGTAGCCTGGGAGGGAAAGG - Intergenic
1089147320 11:116338846-116338868 CACTGGGGCCTGTGGGTTGAGGG + Intergenic
1089213040 11:116819336-116819358 GAGTGTGGCCTGGAGGTGAGCGG + Intergenic
1089341755 11:117763037-117763059 CAGAGTGGTCTGTGGGAGGAAGG - Intronic
1089386055 11:118068773-118068795 CAGTGCCGCCAGGTGGTGGAAGG - Intergenic
1089714002 11:120338017-120338039 CAGTGTTGCATGGTGGTGGGTGG + Intronic
1089812463 11:121143253-121143275 GAGTGTGGCTTGGGAGTGGTGGG - Intronic
1090268183 11:125367937-125367959 CAGCTGGGCCTGGGGGTCGATGG - Exonic
1090347741 11:126084522-126084544 CAGTGCGGGCTGGGGGTGGGGGG + Intergenic
1090401884 11:126454283-126454305 GAGGCAGGCCTGGGGGTGGAGGG + Intronic
1090768205 11:129895441-129895463 AAGTGTCTCCTGGGAGTGGAGGG - Intronic
1090812628 11:130259788-130259810 CAGTGGGGCCTGTTGGGGGATGG + Intronic
1091203827 11:133803941-133803963 CGGTGTTGCCAGGGGCTGGAGGG + Intergenic
1091628356 12:2139810-2139832 CAGTGTGAACTGGAGGTGTAAGG + Intronic
1092900434 12:13054725-13054747 CAGTGAGGCCAAGGGGTGGGTGG + Intronic
1093180809 12:15965457-15965479 CAGTGGGGCCTGTTGGGGGAGGG - Intronic
1093778019 12:23099906-23099928 CAGTGTGGTATGGGAATGGAGGG + Intergenic
1093853735 12:24072552-24072574 AAGTGTGTCCTGGGGGATGACGG + Intergenic
1094176683 12:27548324-27548346 CAGGGGGCCCTGGGGATGGAAGG + Intronic
1094598428 12:31886813-31886835 CATTGTGGCCTGGGGAAGGCGGG - Intergenic
1096048606 12:48586516-48586538 CAGTGTCTCCTGGAGGGGGATGG - Intergenic
1096256411 12:50064672-50064694 CAGTGTGTCCTGGAGGCAGAAGG + Intronic
1096469714 12:51868672-51868694 GAGTGTGGGCTGGGGATGGGAGG - Intergenic
1097282496 12:57853282-57853304 CAGTCTGGGCTGGGGGTACAGGG - Intergenic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1098285680 12:68904758-68904780 CAGCCTGGCATGTGGGTGGAAGG + Intronic
1098440920 12:70517298-70517320 CTGTGTGGCCTGGGTGTGCTTGG - Exonic
1099826064 12:87779541-87779563 CACTGTGGACTGGAGGTGGTGGG - Intergenic
1100099460 12:91085869-91085891 CAGTGGGGCCTGTTGGTGGTAGG - Intergenic
1101015682 12:100497590-100497612 CGTAGAGGCCTGGGGGTGGAAGG + Intronic
1101115921 12:101531093-101531115 CAGTGTCGGCTGGGGGTGAGGGG + Intergenic
1101333787 12:103778561-103778583 CAGTCTGGCCTGGGCATGGCAGG + Intronic
1101904686 12:108815742-108815764 CTCTGTGGCCTTGGGGTGGTTGG - Intronic
1101968149 12:109294760-109294782 CAGTGTGGGCAGGGGGTTGGGGG - Intronic
1102145085 12:110649203-110649225 CAGTGTGGGGTGGGAGTGGATGG + Exonic
1102207617 12:111101195-111101217 CAGTGCGGCCCGGGGGAGGCTGG + Intronic
1102260845 12:111442525-111442547 TAGTGTGGCCTGGGGGTTCCCGG + Intronic
1102539703 12:113609985-113610007 CAGTTTGGCCTCGGGCTGGGCGG + Intergenic
1103088087 12:118077464-118077486 CTGGGTGGCATGGGGGTAGAAGG - Intronic
1103407560 12:120686835-120686857 AAAGGTGGCCTGGGGGGGGAAGG - Intergenic
1103604533 12:122077392-122077414 CAGTCTGGGGTGGGGGTGGCAGG - Intergenic
1103832721 12:123793148-123793170 CAGAGTGGCCTGGCTGTGCAAGG + Intronic
1103847407 12:123911246-123911268 GAATGTGGCCTGGTGGTGGTGGG + Intronic
1103910553 12:124349810-124349832 CCGAGTGCCCTGGGGGTGGCGGG - Intronic
1104037476 12:125107522-125107544 CGGTGTGCCTTGGGGGTGGGGGG + Intronic
1104817037 12:131653421-131653443 CACTGTGGCCTGGTGGGGGTGGG - Intergenic
1104880469 12:132067440-132067462 CTGTGCAGCCTGGGGCTGGATGG - Exonic
1104894560 12:132155522-132155544 CAGTGTGGACTTGGTGGGGACGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1105258203 13:18759292-18759314 CAGTGGGGGGTGGGGGTGGTAGG - Intergenic
1105260860 13:18778592-18778614 CAGTGGGGGGTGGGGGTGGTAGG - Intergenic
1105263171 13:18795183-18795205 CAGTGGGGGGTGGGGGTGGCAGG - Intergenic
1105567717 13:21567325-21567347 TAGTGTGTCCTGGGGTTGGGGGG + Intronic
1105798865 13:23885304-23885326 CAGGGTGGCATGGGGGAGGTGGG + Intronic
1106158966 13:27183680-27183702 AAGTGTGGCCTGTGGGAGGAGGG - Intergenic
1106445212 13:29823863-29823885 CACTGGGGCCTGTGGTTGGATGG - Intronic
1107655197 13:42585727-42585749 CAGTCTGGCCAGGGGGTCTATGG - Intronic
1107963617 13:45579868-45579890 CAGAGTGCCCTGGGTGGGGAAGG - Intronic
1108179814 13:47829451-47829473 CAGTCAGGTCTGGGGCTGGAGGG - Intergenic
1108225672 13:48286501-48286523 CAGTGTGGCCTGGAAGCAGATGG + Intergenic
1110466826 13:75812042-75812064 AAATGTCTCCTGGGGGTGGAGGG - Intronic
1111276096 13:85949309-85949331 CAATGTGGACTGAGGTTGGATGG + Intergenic
1111919070 13:94391801-94391823 CAGCAGGGCCTGGGGGTAGAGGG - Intronic
1112269860 13:97958765-97958787 CAGTGTGGGGTGGGGTGGGATGG - Intronic
1112326141 13:98443894-98443916 CAGTGAGGCCAGGGAGTGGCGGG + Intronic
1112576885 13:100644071-100644093 CGTTCTGGCCTGGGGGTGGGAGG + Intronic
1113034897 13:106037977-106037999 CACTGGGGCCTGTGGGGGGAGGG + Intergenic
1113626983 13:111854784-111854806 CATTTGGGACTGGGGGTGGAGGG + Intergenic
1113853926 13:113433717-113433739 AAGTGTGGGCGGGGGGTGGGAGG - Intronic
1113865256 13:113517796-113517818 AAGTGGGGACTGTGGGTGGAGGG + Intronic
1113895822 13:113764104-113764126 AGGTGTGGCCTGGGGTGGGATGG + Intronic
1114501502 14:23172501-23172523 CATCGTAGCCTGGGGGTGGTGGG + Intronic
1115961025 14:38836276-38836298 CTGTGTGTCCTGAGGCTGGACGG + Intergenic
1117454878 14:55886918-55886940 CAATGTGCCCTGGGGTTGAAAGG + Intergenic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118456433 14:65948982-65949004 GTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1118600810 14:67470463-67470485 CTGGGTGGCCTCAGGGTGGAAGG + Exonic
1118841557 14:69517125-69517147 GAGTGGGGGCTGGGGGTGGGGGG + Intronic
1119441074 14:74629243-74629265 GAATGGGGGCTGGGGGTGGAGGG - Intergenic
1119702881 14:76767404-76767426 CAATGAGGCCTGGGGGAGGTGGG - Intronic
1119966537 14:78922685-78922707 CACTGGGGCCTGTAGGTGGAGGG + Intronic
1121049734 14:90812566-90812588 AAGTGTGGCCTGGGGATGAGTGG - Intronic
1121107122 14:91288313-91288335 CAGTGTGTCCTGTGGCTGGTGGG + Intronic
1121115202 14:91338447-91338469 CTGTGTGTCCTGGGGGTAGCAGG - Intronic
1121588209 14:95078627-95078649 CAGTGTGGCAGCGGGGTGGGGGG - Intergenic
1121716783 14:96081977-96081999 CAGGGTGACCTGGGGGGCGAGGG - Intronic
1121760035 14:96436889-96436911 CAGTGTGGCCTGGGACTGGTTGG + Intronic
1122027299 14:98887094-98887116 TACTCTGGCCTGGGGGCGGAGGG + Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122171416 14:99878514-99878536 GAGTGTCTCCTGGGGGTCGAAGG + Exonic
1122238996 14:100349502-100349524 CTGTGTGGCCTGGGCATGGGAGG - Intronic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122898945 14:104774190-104774212 CAGTGTGATGTGGGGGTGTATGG - Intronic
1202905974 14_GL000194v1_random:72716-72738 CAGTGAGGGCTGGTGGGGGAAGG + Intergenic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1124365586 15:29069021-29069043 CTGTGGGGGCTGGGGGCGGAGGG - Intronic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1125331648 15:38588501-38588523 CAGGGGGGCCGGTGGGTGGAGGG - Intergenic
1125421580 15:39510072-39510094 CTCTGGGGTCTGGGGGTGGAGGG + Intergenic
1125727038 15:41873445-41873467 CAGTGTGGTCTGGGTGATGATGG - Intronic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1126877403 15:53059033-53059055 CAGTTTGGGGTGGGGGTGGGAGG + Intergenic
1126899772 15:53303034-53303056 CAGTTTGTCCTGGGGAGGGAGGG + Intergenic
1126943993 15:53797705-53797727 GAGAGTGGACTGGGGGTGAAAGG + Intergenic
1127029042 15:54841202-54841224 CAGTGTGGCCTGTGGGTCTCAGG - Intergenic
1127297779 15:57624924-57624946 CAGTTAGGACTGAGGGTGGAAGG - Intronic
1127843060 15:62846967-62846989 CAGGCTGACCTGGGGGTGGTGGG + Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129271310 15:74420727-74420749 CAGTTTGGGCTGCGGGTGGAAGG - Intronic
1129359856 15:75017983-75018005 GGGTGTGGCCTGGGGCTGGCAGG + Intronic
1129523741 15:76201313-76201335 CAGAGTGGCCTGAGAGTGGGAGG - Intronic
1129615365 15:77094915-77094937 CCGTGTGGCATGGCTGTGGAGGG - Intergenic
1129666043 15:77579919-77579941 CAGTGTGAGCTGGGGGTGGGGGG - Intergenic
1129672973 15:77617284-77617306 CAGTTTCTCATGGGGGTGGATGG - Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129695049 15:77735674-77735696 CAGTAGGTCCTGGGGGTGGTGGG + Intronic
1129769079 15:78192290-78192312 CAGTGTGGCCTTGGGGAGGATGG - Intronic
1130067276 15:80615196-80615218 TAGTGTGGGCAGTGGGTGGAGGG + Intergenic
1130226229 15:82060199-82060221 CAGTGGGGCCTGCAGTTGGAAGG - Intergenic
1130537905 15:84800015-84800037 CAGTGAGGCTTGGAGCTGGAAGG + Intronic
1131270977 15:90947527-90947549 CAGTGTGGCCTGGGAAGGGGTGG + Intronic
1131493100 15:92880066-92880088 CAGTGTGACTTGGGGGTGGGAGG + Intergenic
1132100535 15:99020039-99020061 CAGTGTGGCCATGGGGTTGGTGG + Intergenic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1132581666 16:687541-687563 AGGTGTGGCATGGGGGTGCAGGG - Exonic
1132842606 16:1985512-1985534 GAGTGTGGCCTGGGTGGGGCTGG - Intronic
1133183860 16:4081120-4081142 TGGTGTGGCCTGGGGAGGGACGG + Intronic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1133827980 16:9295892-9295914 CAGTTTGTTTTGGGGGTGGAGGG - Intergenic
1135434825 16:22419922-22419944 CAGTGTGGGATGGAGGAGGAGGG - Intronic
1136041537 16:27583390-27583412 CAGTGACTTCTGGGGGTGGAGGG - Intronic
1136710886 16:32235317-32235339 GAGTGTGGGCTGGATGTGGAAGG + Intergenic
1136757024 16:32694094-32694116 GAGTGTGGGCTGGATGTGGAAGG - Intergenic
1136811085 16:33176281-33176303 GAGTGTGGGCTGGATGTGGAAGG + Intergenic
1136817561 16:33286361-33286383 GAGTGTGGGCTGGATGTGGAAGG + Intronic
1136824125 16:33342890-33342912 GAGTGTGGGCTGGATGTGGAAGG + Intergenic
1136999270 16:35215189-35215211 GAGTGTGGCCTGGAAGTGGAAGG - Intergenic
1137003681 16:35252946-35252968 GAGTGTGGCCTGGATGTGGAAGG + Intergenic
1137017525 16:35392741-35392763 GAGTGTGGCCTGAATGTGGAAGG - Intergenic
1138533998 16:57650156-57650178 CAGTGTGGCATGGATGTGGGAGG - Intronic
1138556680 16:57775046-57775068 CAGTGTTTGCTGGGGGTGGGAGG + Intronic
1139481939 16:67235680-67235702 GTGTGTGGTGTGGGGGTGGAGGG - Intronic
1140420721 16:74816822-74816844 CTGTGAGGCCTGAGGGTGGGAGG + Intergenic
1140508003 16:75486514-75486536 CTGTGTGGGCTGGGGGGGCAGGG - Intronic
1140757635 16:78082501-78082523 CACTGTGGCCTGTTGGGGGATGG + Intergenic
1141622110 16:85241871-85241893 CAGTGTGGGCTGGGGGTGCCCGG - Intergenic
1141675129 16:85513777-85513799 CAGTGTGCACCGGGGGTGGGGGG - Intergenic
1141675335 16:85514486-85514508 CAGTCAGGCCTGGAGGTGGCGGG + Intergenic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142196817 16:88742805-88742827 CAGTGGGGGCTGCAGGTGGATGG + Intronic
1142277894 16:89132574-89132596 AGGTGGGGCCTGAGGGTGGAGGG - Intronic
1203059173 16_KI270728v1_random:954445-954467 GAGTGTGGGCTGGATGTGGAAGG - Intergenic
1143173001 17:4940785-4940807 AAGTGGGACCTGGGGGTGGTTGG + Exonic
1143176152 17:4956341-4956363 TGGTGTGGGCTGGGGGTGGGGGG - Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143340844 17:6209744-6209766 CAGTGAGGGGTGGGGGTGGGGGG - Intergenic
1143362372 17:6382557-6382579 CAATGTGGCCGGAGGCTGGATGG - Intergenic
1143829366 17:9638760-9638782 CAGTGAGGCGTTGTGGTGGAGGG + Intronic
1144800005 17:17919635-17919657 AAGTGGGGCATGGGGGAGGAGGG + Intronic
1145029235 17:19492017-19492039 CAGTGGATCCTGCGGGTGGAAGG - Intergenic
1145993748 17:29094082-29094104 CAGCTTGGCCTGGAGGTGGTTGG + Exonic
1146532437 17:33620868-33620890 CTGTGGGGGCTGGGGGTGCATGG - Intronic
1146608382 17:34283008-34283030 CACTGGGGCCTGTCGGTGGATGG + Intergenic
1146744253 17:35313967-35313989 CACGCTGGCCTGGGGGTGGTAGG + Intergenic
1146935956 17:36812900-36812922 GTGTGAGGCATGGGGGTGGAGGG - Intergenic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147378253 17:40035832-40035854 ATGTGAGACCTGGGGGTGGATGG - Intronic
1147447609 17:40484306-40484328 CAGGGTGCCTTGGGGCTGGAGGG + Intronic
1147486151 17:40816722-40816744 GATTGTGGCCTGGGGGAGGAGGG + Intergenic
1147918793 17:43904052-43904074 GAGAATGGCTTGGGGGTGGAGGG - Intronic
1148237128 17:45976390-45976412 GAGAGTGGCTTGGGGGTGGTGGG - Intronic
1148567957 17:48644908-48644930 CTGTCTGTCCTGGGGGTGGGAGG + Intergenic
1149427546 17:56569680-56569702 CAGTTTGGCCTGGGAGGGCAGGG + Intergenic
1149989199 17:61371422-61371444 CAGAGTGGTCTGGGGGTTGAAGG + Intronic
1151668453 17:75558649-75558671 CAGGCTGGGCTGGGAGTGGAAGG - Intronic
1151936732 17:77266518-77266540 CACTGTGGGATGGGGGTGGAGGG - Intergenic
1152460912 17:80441856-80441878 CACTGTGGCCTGGGGTCGGGGGG + Intergenic
1152499487 17:80698301-80698323 CAGTGAGGCCTGGGTGGGGGTGG - Intronic
1152658018 17:81528938-81528960 CAGGTGGGCCTGCGGGTGGATGG - Exonic
1152697157 17:81803206-81803228 CAGGGATGGCTGGGGGTGGAAGG + Intergenic
1153568776 18:6447253-6447275 CAGTGTCCCCTGTGGGTGGCTGG + Intergenic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1153971817 18:10234060-10234082 CAGTGTGGCCTGAGTCAGGATGG - Intergenic
1154349663 18:13572410-13572432 CAGCCTGGGCTGGGAGTGGAAGG + Intronic
1154428268 18:14288661-14288683 CAGTGGGAGCTGGGGGTGGGGGG + Intergenic
1154432845 18:14321439-14321461 CAGTGGGGTGTGGGGGTGGTAGG + Intergenic
1156480005 18:37430442-37430464 TTGTGTGGAGTGGGGGTGGAGGG - Intronic
1156578965 18:38353229-38353251 TAGTGTGGACAAGGGGTGGAGGG + Intergenic
1157289088 18:46397241-46397263 GAGTGAGGACTGGGGGTGGGAGG + Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1158628772 18:59093931-59093953 CAGTGGGTCCTGGGCGTGGTGGG - Intergenic
1158857286 18:61555262-61555284 CAGCCTTGCATGGGGGTGGATGG + Exonic
1159935492 18:74363571-74363593 CATGGTGTCCTGCGGGTGGAGGG - Intergenic
1160402415 18:78620631-78620653 CAGTGTGGCCTTGGGGCACAGGG - Intergenic
1160509304 18:79444424-79444446 CAGCGTGGGCTCGGGGTGGGTGG - Intronic
1160596905 18:79982105-79982127 CAGTGTGGTCACGGGGTGGCAGG + Intronic
1160612758 18:80101399-80101421 CAGTGTGGTTTGGGGGTAGGAGG - Intergenic
1160878818 19:1310449-1310471 CAGCGAAGGCTGGGGGTGGAAGG + Intergenic
1160894318 19:1395588-1395610 CAGTGTGGTGTGTGGGTGAAAGG + Exonic
1161021929 19:2014874-2014896 CAGGGGGGCCTGGGGATGGAGGG + Intronic
1161143873 19:2665351-2665373 CAGTGTCCCCTGGGGGGGGGGGG + Intronic
1161308601 19:3581091-3581113 CAGTGTGGGATGGAGGTGGGCGG - Intergenic
1161395267 19:4042168-4042190 CAGTGTGCCCTGAGGGTCCACGG + Intergenic
1161567109 19:5009412-5009434 CAGTGGGGCCTGGAAGTGGAAGG + Intronic
1161815778 19:6498999-6499021 CTGGGTGGCCAGGGGGTGGGAGG + Intronic
1162418542 19:10552742-10552764 CACTGTGGCCAGGGGATGGAAGG + Intronic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162523590 19:11195295-11195317 CAGGAAGTCCTGGGGGTGGAGGG + Intronic
1162818059 19:13207944-13207966 ACGTGTGGCCGGGGGGTGGAGGG + Exonic
1162897250 19:13772354-13772376 AAGTGTGGTCAGGGGCTGGACGG - Exonic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163399980 19:17086263-17086285 CAGTGTGGCCGGTGGGTCCAAGG - Intronic
1163558766 19:18007043-18007065 CAGTGAGGTGTGTGGGTGGAGGG - Intronic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163643252 19:18473807-18473829 CAGTGGGGCCAGGTGGTGCAGGG - Intronic
1165413670 19:35677919-35677941 CTGGGTGGGCTGGGGGTGGGGGG + Intronic
1165495923 19:36151943-36151965 GAGTCTGGCCTGGGGGTGACCGG + Intronic
1165584424 19:36901336-36901358 CATGGTTGCCTGGGGCTGGAGGG + Intronic
1165729558 19:38136007-38136029 CCTTGTGGCCTGGGGGTAGGAGG - Intronic
1165757768 19:38304297-38304319 GAGTGTGGACTGGAGGTGCAGGG + Intronic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1165811428 19:38614226-38614248 CAAGGTGGTCTGGGGGTGTAGGG - Exonic
1165825922 19:38705695-38705717 CAGTGTGTTCTGGTGGTGAAAGG + Intronic
1165954004 19:39490300-39490322 CAGTGTGGCCCTGGGGTAAAGGG + Exonic
1166071369 19:40390064-40390086 CAGTGTGGCCTGGGGGTTTGGGG - Exonic
1166352048 19:42203884-42203906 CAGTGTGGCCCTGAGGTGGCAGG + Intronic
1166645631 19:44529715-44529737 AAGTGAGCCCTGGGGGTAGAGGG - Intronic
1167148344 19:47695351-47695373 GAGGGAGGCCTGGGGGTGGGTGG - Exonic
1167384063 19:49153830-49153852 CTGTGTGTCCTGGGGGGTGATGG + Exonic
1167661537 19:50798559-50798581 CATGGTGGGCTGGGGCTGGAAGG + Exonic
1168305527 19:55433234-55433256 CAGCGTGCCCTGGCGCTGGAAGG + Exonic
1168324465 19:55530898-55530920 CAGTGTGACCTGGGGCTGCCTGG + Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168488819 19:56790016-56790038 CAGGGTGGCATGAGGGTGGCTGG - Intronic
1168511485 19:56977227-56977249 CAGCATGGCCAGGGGGTGGTGGG + Intergenic
1168557223 19:57353222-57353244 CAGAGTGGCATGGGGGATGAGGG + Intronic
925173718 2:1767933-1767955 AAGTGTGGGGTGGGGGTAGAGGG + Intergenic
925353751 2:3222694-3222716 GAGGGAGGCCTGGGCGTGGAGGG + Intronic
926012193 2:9417208-9417230 CAGCGTGGCCTGGGCGAGGCAGG - Intronic
926293255 2:11547875-11547897 CAGTGTGTTCTTGGGGTAGAAGG - Intronic
926333081 2:11841337-11841359 TAGAATGGCCTGGGGGTGTATGG + Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
927155715 2:20220049-20220071 CCATGTGGACTGGGTGTGGAGGG - Intronic
927431178 2:23027537-23027559 GTGTGTGGCCAGGGTGTGGAAGG - Intergenic
927517946 2:23682856-23682878 CAGTGTGACTTGGGGTTGGCGGG + Intronic
927940981 2:27102583-27102605 GAGTCTGGCCTGGAGGAGGAAGG + Exonic
927945731 2:27134211-27134233 CAGGGTGGCCGGGGGGTCGCGGG - Intronic
929082162 2:38131899-38131921 AACTATGGCCTGTGGGTGGAGGG - Intergenic
929211383 2:39360646-39360668 CAGTGTGGCATGGCTGGGGAGGG + Intronic
929570288 2:43018645-43018667 CACAGTGGCATGGGTGTGGAGGG + Intergenic
929928260 2:46232840-46232862 CAGGGTGAAATGGGGGTGGAGGG - Intergenic
930036110 2:47086146-47086168 CAGTGTGGCCTGAGCCTGGGAGG - Intronic
931091408 2:58890581-58890603 CACTGGGGCCTGTTGGTGGATGG - Intergenic
931432104 2:62216360-62216382 GAGGGAGGCCTGGGGGAGGAGGG + Intronic
932408348 2:71529041-71529063 CAGAGAGGCCTGGGGTTGAAGGG - Intronic
932579310 2:72983197-72983219 CCGTGTGGCCTTGGGGAGAAGGG + Intronic
932594019 2:73083162-73083184 GAGTGTGGCTTGGGGTAGGAAGG + Intronic
933421236 2:82047651-82047673 CACTGGGGCCTGTTGGTGGATGG + Intergenic
934492954 2:94774703-94774725 CAGTGGGGGGTGGGGGTGGTGGG - Intergenic
934771661 2:96911506-96911528 CGGTGCAGCCTGGGGTTGGAGGG - Intronic
934874973 2:97909242-97909264 CAGTGTGGCAGTGGGATGGATGG + Intronic
936010402 2:108921766-108921788 CAGATAGGCCTTGGGGTGGATGG - Intronic
937831488 2:126429330-126429352 CTGTGGGGGCTGGGGGTGCAGGG - Intergenic
938179001 2:129162860-129162882 CAGTGGGGGCTGGGGGTGTGTGG + Intergenic
938264339 2:129915685-129915707 CAGAGAGGCCTGGTGGTAGATGG - Intergenic
938689678 2:133776157-133776179 CAGCAAGGCCTGGGGATGGAGGG + Intergenic
938727772 2:134121991-134122013 CAGTGAGGACGGGGGGAGGAGGG - Intronic
940014697 2:149091994-149092016 CAGATTGGGCTGCGGGTGGAAGG + Intronic
940349118 2:152661293-152661315 CACTCTGGCCTAGGAGTGGATGG + Intronic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
943763521 2:191635531-191635553 AAGGCTGGCCTGGGGATGGAGGG + Intergenic
944604948 2:201344397-201344419 CATTATGGGGTGGGGGTGGAGGG + Intronic
945694575 2:213086775-213086797 TAGTGTGGAATGGGAGTGGAGGG + Intronic
947698071 2:232209534-232209556 GAGTGTGGCATGGGGGCAGAAGG + Intronic
947794167 2:232883894-232883916 GATTGTGGCCTGGGGGTTGGGGG - Intronic
947800718 2:232927580-232927602 CCGTGTGGCCTGGGGACGGGAGG - Intronic
948186786 2:236027515-236027537 CAGTCTGCCCTGGGGGAGGCAGG - Intronic
948303940 2:236932692-236932714 GAGAGTAGCCTGGGGGTGGGGGG + Intergenic
948303946 2:236932729-236932751 CAGAGTAGCCTCGGGGTAGAGGG + Intergenic
948433291 2:237934438-237934460 CAGGGAGGGCTGGGGCTGGATGG - Intergenic
948668629 2:239552241-239552263 CAGCCCAGCCTGGGGGTGGAGGG + Intergenic
948803130 2:240441808-240441830 GTGTGGGGCCTGGAGGTGGAGGG - Intronic
948980300 2:241491139-241491161 CAGTGCGGCCTGGCAGTGCAGGG - Exonic
1169245102 20:4018852-4018874 CAGTGGGGGCTGGGAGTGGTGGG - Intergenic
1170683506 20:18547724-18547746 CAGTGGGGAGTGGGGGTGGAGGG - Intronic
1171186373 20:23126865-23126887 CAATGTGGCTTTGGGGTGAAAGG + Intergenic
1171357981 20:24565405-24565427 CAAGGAGGCCTGGTGGTGGAGGG + Intronic
1171499120 20:25579560-25579582 CAGGGTGGCGTGGGGGTGTGGGG - Intronic
1172211153 20:33199481-33199503 CAGCCTGGACTGGGGGTGGTTGG - Intergenic
1172468307 20:35173244-35173266 CAGTGTGGCCTGTGTGTGTTTGG + Intronic
1172617628 20:36299516-36299538 CCTTGTGGCCTGGGGGTGAATGG + Intergenic
1172764793 20:37345830-37345852 CATTTTGGCCTGGGGGCGGATGG + Intronic
1172881486 20:38202704-38202726 CAGCCTGACCTGGGGGTGGAGGG + Intergenic
1172993397 20:39052245-39052267 CAGTGAGGGGTGGGGGTGGGAGG + Intergenic
1173405753 20:42763045-42763067 GGGTCTTGCCTGGGGGTGGAAGG - Intronic
1173572471 20:44086286-44086308 CATTGTGGCCTCGGTGTGGCAGG + Intergenic
1173759560 20:45547557-45547579 CAGTGCAGCCTAGGGGTGTAAGG - Intronic
1174395694 20:50245646-50245668 CAGTGTGGCCAGGCTGTGGGAGG + Intergenic
1174485955 20:50861395-50861417 CAGTGTGGGCCTGGGGTGGAGGG + Intronic
1174498865 20:50969528-50969550 AAGATTGGCCTGGGGGTGGGGGG - Intergenic
1175009486 20:55720763-55720785 CAATGTGCCCAGGGTGTGGAGGG + Intergenic
1175817818 20:61892830-61892852 CAGTTTGGCTTGGGGCTGGCTGG + Intronic
1175929694 20:62487828-62487850 CCGTTGGGGCTGGGGGTGGAGGG + Intergenic
1176222352 20:63975654-63975676 CAGAGAGGCCTGGGGGCTGATGG - Intronic
1176275339 20:64262934-64262956 CAGGGTGGCCGGGGGGTGTCAGG - Intronic
1176379731 21:6106236-6106258 GCGTGAGGCCTGTGGGTGGAAGG - Intergenic
1176844202 21:13864316-13864338 CAGTGGGGGGTGGGGGTGGTAGG - Intergenic
1178377061 21:32075543-32075565 AAGTGTGGCCGGGGGGCGGGGGG - Intergenic
1178431500 21:32522196-32522218 GAGTGTGGCCAGGGGACGGAAGG - Intergenic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1178924068 21:36760746-36760768 TGGTGTGGCCTGGGGGTGGGGGG + Intronic
1179176341 21:39010759-39010781 GAGGGAGGCCTGGGGGTGGCAGG - Intergenic
1179603528 21:42496759-42496781 CTGCGAGGCCTGGGGGCGGAAGG - Intronic
1179743743 21:43432001-43432023 GCGTGAGGCCTGTGGGTGGAAGG + Intergenic
1179766218 21:43574953-43574975 CTGTCAGGCCTGGGAGTGGAAGG - Intronic
1180087533 21:45514666-45514688 CGGCCTGGCCTGGGGGTTGAGGG - Exonic
1180534778 22:16387632-16387654 CAGAGTGTCCTGGGGGAGGCAGG + Intergenic
1180937162 22:19633360-19633382 CACTGGAGCCTGGGAGTGGAGGG - Intergenic
1181054894 22:20256256-20256278 CAGTGTGGCCTTGGACTTGAGGG - Intronic
1181058656 22:20271605-20271627 CAGTGTCTCCTGGGGAGGGATGG + Intronic
1182422628 22:30256033-30256055 CAGGCTGGCCTGGGGCTGGCGGG - Intergenic
1182787058 22:32916935-32916957 CTGTGTTGCCTGGGTGAGGAGGG + Intronic
1182885919 22:33774070-33774092 AAGGGTGGGGTGGGGGTGGAGGG + Intronic
1183201348 22:36387569-36387591 CAGCGAGGCCTAGGGGTGCAGGG - Intronic
1183394671 22:37564638-37564660 CAGTGTAGCCTGGGGCTCCAGGG + Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183420983 22:37711037-37711059 CACTCAGGCCTGAGGGTGGAAGG - Intronic
1183494609 22:38135483-38135505 CAGTGTGGTAAGGAGGTGGAGGG - Intronic
1183545461 22:38452874-38452896 CAGTGTGGGGTGGGGGTGGCGGG - Intronic
1184173196 22:42771551-42771573 CAGTGAGGCCTGGGGTTGGACGG + Intergenic
1184286260 22:43473449-43473471 CACAGGGGCCTCGGGGTGGATGG - Intronic
1184406684 22:44304536-44304558 CAGAGAGGCCTGCGGGTGGATGG - Intronic
1184489734 22:44801656-44801678 CAGGGTGGCCTGGGGGACAATGG - Intronic
1184497283 22:44849230-44849252 CAGTGTGGACTGGCTGTGCATGG - Intronic
1184514312 22:44952471-44952493 CCGTCTATCCTGGGGGTGGAGGG + Intronic
1184583766 22:45434188-45434210 TGGTGTGGGGTGGGGGTGGAAGG + Intergenic
1184880640 22:47302278-47302300 CACTGTGGCTTGGGTGTGGAGGG + Intergenic
1185109519 22:48893328-48893350 CAGAGAGACCTGGGTGTGGACGG + Intergenic
1185337658 22:50278005-50278027 CAGTGTGCCCTGTGGGGGGGAGG + Exonic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950207360 3:11091456-11091478 GGGCGTGGCCTGGGGGTGAAGGG - Intergenic
950371873 3:12537654-12537676 CAGTGTGGCCCAGGGGTTAAGGG + Intronic
950549716 3:13658868-13658890 CAGTCTGGCATGGGTGTGGGCGG - Intergenic
950859718 3:16137363-16137385 CAGTGGGGTATGGGGGGGGAGGG - Intergenic
950880171 3:16316967-16316989 CTGTGTGGGGTGGGTGTGGAGGG - Exonic
950957156 3:17066124-17066146 GTGTGTGGCATTGGGGTGGAAGG + Intronic
952269136 3:31815288-31815310 CAGTTTGGTCTGGGTGTGGCAGG - Intronic
952773522 3:37022977-37022999 CAGTGTGACCTGCTGGTGGCAGG - Intronic
952972095 3:38657886-38657908 CCGTGGTGGCTGGGGGTGGAGGG + Intergenic
953123644 3:40070700-40070722 CAGGGTGGTAAGGGGGTGGATGG - Intronic
954380206 3:50215289-50215311 CTGGGAGGCCTGGGGGTGGAGGG - Intronic
954418338 3:50405224-50405246 CTGGTTGGGCTGGGGGTGGAGGG + Intronic
954579698 3:51696601-51696623 TAGTGGGGGCTGGGGATGGAAGG - Intronic
954633642 3:52059849-52059871 CAGTGTGGTGTGGTAGTGGATGG - Intergenic
954677692 3:52324797-52324819 CAGGGTGGGCTGGGGGTGATTGG + Intronic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
955112339 3:55961197-55961219 CAGTGTAGCTTGGGGGAGTAGGG - Intronic
955784933 3:62527439-62527461 CTGTGTGTGCTGGGGGTGGGGGG + Intronic
956056121 3:65300853-65300875 CACTGGGGTCTGGGGGAGGAGGG - Intergenic
960991087 3:123311804-123311826 TTGTGTGGCCTGGGGGTAGAGGG + Intronic
961115208 3:124323394-124323416 CCCTGTGGGCAGGGGGTGGATGG + Intronic
961329001 3:126128018-126128040 CAGTGGGGCATGAGGGTGGAGGG + Intronic
961371872 3:126436176-126436198 CAGAGTGGCCTGGAGGTGACTGG + Intronic
961457223 3:127030229-127030251 CAGTGTGCCCTGCGGGGGGCAGG - Exonic
961528409 3:127524134-127524156 CAGTGTTGGCGGGGGGTGTAGGG - Intergenic
961530200 3:127536003-127536025 CCGTGAGTCCTGGGGGTGCAGGG - Intergenic
961649214 3:128409079-128409101 CAGGGTGGTCTGTGGGTGCAGGG - Intergenic
962485793 3:135841055-135841077 CAGTATGGGGTGAGGGTGGAGGG - Intergenic
962951357 3:140222322-140222344 TAGTGAGGGATGGGGGTGGAAGG + Intronic
964229625 3:154449766-154449788 CAGTGGGGCCTGTAGGGGGAGGG - Intergenic
966384443 3:179380724-179380746 AACTGAGGCCTGGGTGTGGAAGG + Intronic
966549768 3:181192322-181192344 CAGCCTGGTCTGGAGGTGGATGG + Intergenic
966775547 3:183540096-183540118 CATTGTGGCTTGGGCTTGGACGG - Intronic
967010831 3:185432013-185432035 CATGGGGGCCAGGGGGTGGAGGG - Intronic
967118023 3:186359779-186359801 CAGTGTGGGATGGGAGTGGTAGG + Intronic
967840918 3:194003806-194003828 CAGTGGGGCCTGGGTTAGGAGGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968511601 4:998101-998123 CAGTGTGTCCTTTGGATGGAGGG + Intronic
968516397 4:1017396-1017418 CAGTGTGCGCTGGGGAGGGAGGG - Intronic
968530072 4:1086847-1086869 GAGGATGGCATGGGGGTGGAAGG + Intronic
968829967 4:2928301-2928323 CAGTGGGGCTTGGGGGTCTATGG - Exonic
968958405 4:3730539-3730561 CCGTGGGGGCTGGGGGTGCAGGG + Intergenic
968958419 4:3730569-3730591 CGGTGGGGGCTGGGGGTGCAGGG + Intergenic
968958445 4:3730629-3730651 CAGTGGGGGCTGGGGGTGCAGGG + Intergenic
968958459 4:3730659-3730681 CAGTGGGGGCTGGGGGTGCAGGG + Intergenic
968960398 4:3740287-3740309 AGGTGTGGCCTGGGTGTGGGAGG + Intergenic
969134584 4:5019824-5019846 CAGTCAGGCCTGGGTTTGGATGG + Intergenic
969396484 4:6924884-6924906 GCTTGTGGCCTGGGGGTGGTGGG + Intronic
969629672 4:8328977-8328999 GACTCTGGCCTGGGGGAGGAAGG + Intergenic
969691260 4:8705400-8705422 CAGGGTGGCCTGGGGAGAGAGGG + Intergenic
969965323 4:10987960-10987982 CACTGGGGCCTGTTGGTGGAGGG - Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
975141642 4:70924638-70924660 CACTGTGGCCTGCTGGTGGGTGG - Intronic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
975944203 4:79684940-79684962 CAATGTGTGTTGGGGGTGGAGGG - Intergenic
976212005 4:82680989-82681011 CAGTGAGGACTGGTGGGGGAGGG - Intronic
976783239 4:88785795-88785817 CAGTGTGGGCTGGGAGTTGAAGG + Intronic
978028936 4:103914439-103914461 CACTGTGGCCTGGTGGGGGTAGG + Intergenic
979844656 4:125491866-125491888 CAGTATGGACTAGTGGTGGAGGG + Exonic
981161069 4:141499532-141499554 CACTGTGTCCTCGTGGTGGAAGG + Intergenic
981207370 4:142059225-142059247 CAATGTCTCCTGTGGGTGGAGGG + Intronic
981748448 4:148072211-148072233 CAGTCAGCCCTGGGGGTGGGGGG + Exonic
982166456 4:152617875-152617897 CAGTGTGGCCTGAGAGTGCAAGG - Intergenic
983639670 4:169933409-169933431 TAGAGTGACCTGGGGGAGGATGG + Intergenic
983645177 4:169982299-169982321 AAGTGTGTTCTGGGGGTGGGAGG + Intergenic
983889209 4:173013573-173013595 CATTTTAGCCTGGGGGTGGGAGG - Intronic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
985670751 5:1205431-1205453 CAGAGAGGACTGGGGGTGGGGGG - Intronic
985776082 5:1843049-1843071 CGGTGTGTGCTGGGGGTGGGTGG + Intergenic
985965821 5:3338273-3338295 GAGGGTGTCCTGTGGGTGGAGGG + Intergenic
986734702 5:10660355-10660377 CAGTGTGGCCTGGGCAGGGGTGG + Intergenic
986806307 5:11311806-11311828 GAGTGTGGGCTGAGGGTGTATGG - Intronic
986991759 5:13561910-13561932 CACTGGGGCCTGTGGGGGGATGG + Intergenic
989190658 5:38666829-38666851 CAGTGGGGCCTGGGCCAGGAGGG + Intergenic
989616159 5:43338769-43338791 CAGTGTAGCTTAGTGGTGGAAGG + Intergenic
990370570 5:55114310-55114332 CCCTGTGGCCTGGGGGAAGAAGG + Exonic
990521843 5:56588606-56588628 CAGAGTGGCTTGGGGGTCGGGGG + Intronic
992152087 5:73914824-73914846 CAGTGAGTCCAGGAGGTGGATGG - Intronic
992387297 5:76297405-76297427 ACTTGTGGCCTGGGGATGGATGG + Intronic
995951912 5:117725377-117725399 CACTGTGGCCTGTCGGGGGATGG - Intergenic
998366680 5:141636921-141636943 GGGCGTGGCCTGGGTGTGGATGG - Intergenic
998443590 5:142181530-142181552 CAGAATGTCCTGGGGTTGGAAGG + Intergenic
998569299 5:143243185-143243207 CAGTGTCCTCTGGGGCTGGAAGG - Intergenic
999202236 5:149824686-149824708 GAGTCTGGCCTGAGGGTTGAAGG + Intronic
999765898 5:154740649-154740671 CAGTGTAGCATAGGGGTGAAAGG - Intronic
1000490420 5:161905891-161905913 CACTGTGGCCTGTTGGGGGATGG + Intergenic
1001396397 5:171421723-171421745 CATTGGGGCTTGGGGATGGAAGG + Intronic
1003357471 6:5387095-5387117 CAGCATGGTCTGGGGCTGGAGGG + Intronic
1003429284 6:6024153-6024175 CAGTGGGGGCTGGTGGTGGTGGG + Intergenic
1003635261 6:7826107-7826129 CAGTGGTGCCTGAGGGTGGTTGG + Intronic
1003980013 6:11380576-11380598 CAGTGAGGCCTGGAGGAGGGAGG + Intronic
1005250418 6:23939734-23939756 CAGTGTGGTCTGAGTGTGGTTGG - Intergenic
1005809018 6:29502254-29502276 AGGTGTGGCCTGGGGATTGAAGG - Intergenic
1005989222 6:30892920-30892942 CAGTGGGGGCTGGGGGAGCAGGG - Intronic
1006379667 6:33690209-33690231 CTGGGTGGGCTGGGGCTGGATGG + Intronic
1006401685 6:33821483-33821505 CCATCTGGCCTGGGGGTGGGTGG - Intergenic
1006582894 6:35086864-35086886 CAGCCTGGCCTGGGGGTGGGAGG + Intronic
1007223535 6:40296991-40297013 CGGGGTGGGCTGGGGGTGGGGGG + Intergenic
1007315260 6:40983140-40983162 CAGTGTGGAGTGGGGAGGGAAGG - Intergenic
1007747369 6:44051403-44051425 CGGTGAGGCCTGGGGTAGGAGGG + Intergenic
1007747387 6:44051453-44051475 CAGTGGGGCCTGGGGTAGGAGGG + Intergenic
1007747399 6:44051478-44051500 CACTGGGGCCTGGGGTGGGAGGG + Intergenic
1008001175 6:46361340-46361362 CAGTGTGGCCTGGGAGTCAAAGG - Intronic
1008433648 6:51449830-51449852 CAGGCTGGGCTGGGTGTGGAAGG + Intergenic
1008598744 6:53068087-53068109 CAGGGCGGCCAGGGGGGGGAGGG - Intronic
1010126909 6:72443027-72443049 AAGTGTGGTCTGGGAGTGGAAGG + Intergenic
1010583511 6:77628520-77628542 CACTGGGGCCTGGGGGGGGTGGG - Intergenic
1013013929 6:106144170-106144192 CTGTGGGGCCTGGGGGTGGGAGG - Intergenic
1013408816 6:109866173-109866195 CTGCGTGGCATGGGGGTGCAGGG + Intergenic
1013480332 6:110547432-110547454 AAATGTGGCATGGGGGTGGAGGG - Intergenic
1014111061 6:117619007-117619029 CACTGTGGCCTTGGGGTTGAGGG - Intergenic
1014448971 6:121561604-121561626 CACTGTGGCCTGTCGGTGGGTGG - Intergenic
1014842373 6:126235685-126235707 CAGTGGGGCCTGTTGGAGGATGG + Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1015843309 6:137494909-137494931 CAGCGGGGGCTGGGGGTGGTGGG + Intergenic
1016902870 6:149119042-149119064 CAGTGAGGCCTGGTGGGGTATGG - Intergenic
1017689420 6:156948409-156948431 CAGTGGGTGGTGGGGGTGGAGGG + Intronic
1017767621 6:157619568-157619590 CAGTGAGACCTGGGTGGGGAGGG + Intronic
1017875398 6:158520084-158520106 GAGAGTGGCCTGGGGGAAGAGGG - Intergenic
1018137452 6:160791467-160791489 CATTGTGGCCTTGGGGATGAGGG - Intergenic
1018307292 6:162471045-162471067 GAGTGTGGGCTGGGCGTGGTGGG - Intronic
1018804624 6:167249182-167249204 CTGTGTGCCCTGGGGGTGCTGGG - Intergenic
1018825917 6:167407864-167407886 CTGTGTGCCCTGGGGGTGCTGGG - Intergenic
1018840612 6:167514123-167514145 CAGTGTGACTGGGGGGTGGGGGG + Intergenic
1018998162 6:168725878-168725900 CACTGTGGCTTTGGGGTGGAGGG - Intergenic
1019351482 7:556114-556136 CAGGGTGGCCTGGGGGTGCCTGG - Intronic
1019354857 7:573134-573156 CAGTGTGACCCCGGGGTGCAGGG - Intronic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019476017 7:1244669-1244691 CAGAGAGGCCTGGGGGTGTCTGG + Intergenic
1019494712 7:1332380-1332402 CAGTGCAGCCTGGGCGTGGAGGG - Intergenic
1019593214 7:1846138-1846160 CACTGTGGTCTGGGGCCGGATGG - Intronic
1019611880 7:1940925-1940947 GGGTGAGGCCTGGGGGAGGAGGG - Intronic
1019709805 7:2513046-2513068 CACTGTGGGCTGGGGCTGGGAGG - Intronic
1020109517 7:5440125-5440147 GAGTGTGGGCTGTGGGTGCATGG + Intronic
1020834226 7:13128162-13128184 CAGCCTGGGCTGGGTGTGGATGG + Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1021842341 7:24731070-24731092 TAGTGTGGCCTGGGGGTCTCAGG + Intronic
1022044805 7:26614127-26614149 CAGAGTGGCTGGGGGGTTGAAGG + Intergenic
1022221294 7:28316209-28316231 TGGTTTGGGCTGGGGGTGGAGGG + Intronic
1022479328 7:30732930-30732952 CAACGTGGCCTGGGTGTGGCTGG - Intronic
1022892967 7:34719945-34719967 AAGTGTGGCATGGGCATGGAGGG - Intronic
1023861399 7:44219566-44219588 CAGCAGAGCCTGGGGGTGGATGG - Intronic
1023908541 7:44538560-44538582 CAGAGTGGACTCGGGGTTGAAGG + Intronic
1024039892 7:45544577-45544599 CAGACTGGGCTGGGGCTGGATGG - Intergenic
1025139990 7:56454823-56454845 CACTGTTGCCTGGTGGTGGCAGG - Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025239694 7:57260829-57260851 CATTGTTGCCTGGTGGTGGTGGG - Intergenic
1026014939 7:66665466-66665488 CAGTGTGTCCTGCTGGGGGATGG + Intronic
1026024187 7:66732052-66732074 CAGGCTGGGCTGGGGGTGGCTGG - Intronic
1026286691 7:68969467-68969489 CAGTGAGGCCTGGGCCTGTAAGG + Intergenic
1026888911 7:73970944-73970966 CAGGCTGGGCTGGGGGTGGCAGG - Intergenic
1029043049 7:97597728-97597750 CAGTGTTGCCTGGGACTGTAGGG + Intergenic
1029451372 7:100643179-100643201 CAATGTGGCATGGGGGTTAAGGG + Exonic
1029582642 7:101447622-101447644 CAGTGGGGTCTGGAGGTGGGTGG + Intronic
1029799359 7:102930011-102930033 CAGTTTGGGCTAGGGGTGGTGGG + Intronic
1029996655 7:105013718-105013740 CAGACTGGGCTGGGGGAGGAGGG + Intergenic
1030139905 7:106293731-106293753 CAGGGTGGGGCGGGGGTGGAGGG - Intergenic
1030199746 7:106890794-106890816 CAGTGTGGCATGAGGCTGGAGGG - Intronic
1030483204 7:110130478-110130500 CAGTGTTGCCTGTGCCTGGATGG - Intergenic
1030723223 7:112894139-112894161 TAGAGAGGCCTGGGGGTGAAGGG + Intronic
1031288405 7:119901184-119901206 CTGTGTTGCCTGGGGCTGGGTGG + Intergenic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1032237214 7:130135837-130135859 CACAGTGGAGTGGGGGTGGAAGG - Intergenic
1032706361 7:134423831-134423853 GAGTGTGGCATGGGGCTGGTGGG + Intergenic
1032713436 7:134483213-134483235 CACTGGGGAGTGGGGGTGGAAGG + Intergenic
1032805352 7:135348688-135348710 CAATGTGGCCTGGGGGAGGGTGG + Intergenic
1033682413 7:143607779-143607801 CAGTGGGGCCTGGGGAGGGAGGG - Intergenic
1033702476 7:143854134-143854156 CAGTGGGGCCTGGGGAGGGAGGG + Exonic
1033827644 7:145211061-145211083 CAAAGTGGACTGGGAGTGGATGG + Intergenic
1034460543 7:151195683-151195705 CGGGGTGGCCTGGGGCTGGGAGG + Intronic
1034714543 7:153229166-153229188 CACTGGGGCCTGTTGGTGGAAGG - Intergenic
1035034728 7:155887259-155887281 CACTGTGGGCTGGGGGTGGAAGG + Intergenic
1035300566 7:157894696-157894718 CCATGTGGCCTTGGGGTGGATGG + Intronic
1035337352 7:158138434-158138456 CTGAGTGGCCTGGAGCTGGACGG - Exonic
1035756458 8:2036449-2036471 GAGTGTGGTATGGGGGTGCAGGG + Intergenic
1035771736 8:2153076-2153098 CAGTGTGGCCTGGGGCAGGTGGG + Intronic
1036170184 8:6475946-6475968 CATTGAGGACTGGGGGTGGCAGG + Intronic
1036646897 8:10616640-10616662 CCCTGAGGCCTGGGGGAGGAAGG + Intronic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037059141 8:14485263-14485285 CAGCGGGGGCAGGGGGTGGAGGG - Intronic
1037383804 8:18316293-18316315 CACTGTGGCCTGGCGGAGGATGG - Intergenic
1037635896 8:20700855-20700877 CAGGGAGGCCTGGGGCTGGATGG + Intergenic
1037665088 8:20962165-20962187 CAGTGGGGCCTGTTGGGGGATGG + Intergenic
1037738593 8:21586715-21586737 CACTGGGGCCTGGTGGAGGAGGG - Intergenic
1037796273 8:21997836-21997858 CAGTGTGGTGGGGGGGAGGAAGG + Intronic
1038205798 8:25463840-25463862 CAGTGTGCCCTGTGAGTGGAAGG - Intronic
1038328575 8:26590456-26590478 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328585 8:26590516-26590538 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328595 8:26590576-26590598 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328605 8:26590636-26590658 CAGTGACACCTGAGGGTGGATGG - Intronic
1039557162 8:38484779-38484801 AAGTGTGGCCTGGGCTGGGAGGG + Intergenic
1039621064 8:38997227-38997249 CTGTGGTGCCTGGGAGTGGAGGG + Intronic
1040312965 8:46246224-46246246 CAGGGTGGCCTGGGCGGGCAGGG + Intergenic
1040734790 8:50491891-50491913 CACTGGGGCCTGCGGGTGGTAGG - Intronic
1042947491 8:74169832-74169854 ATGTGTGGGCTGGGGGTGGGAGG + Intergenic
1043160517 8:76840890-76840912 CAGCGTGGCCTGGTGCTGGGAGG + Intronic
1043740242 8:83801890-83801912 CTGTGTAGCCTGGGGTTGGAGGG + Intergenic
1044434930 8:92150821-92150843 CTGTCTGGGGTGGGGGTGGAGGG + Intergenic
1046075424 8:109306634-109306656 CAGTGGGGTCCGGGGGTGGGGGG - Intronic
1046809580 8:118517844-118517866 CAGAATGGGCTGGGGGAGGAGGG + Intronic
1047274575 8:123396099-123396121 CGGAGGGGCCTGGGGGTGGGCGG - Intronic
1048234277 8:132675050-132675072 CAGTGTAGCCTAATGGTGGAGGG - Intronic
1048604405 8:135952715-135952737 CAGACTGCCCTGTGGGTGGAAGG + Intergenic
1049227834 8:141466170-141466192 CAGTGTGGCCTGGCTGGGGCAGG + Intergenic
1049324830 8:142016451-142016473 CAGAGAGGCCTGGAGGAGGACGG - Intergenic
1051818165 9:21133939-21133961 GAGTGTGCTCTGGGTGTGGAAGG - Intergenic
1052976048 9:34411040-34411062 CAGTGTGCCCTGGGAGTGGCTGG + Intronic
1053055773 9:34992293-34992315 CAGGGTGGACTGGGGGCGTAGGG + Intronic
1053365562 9:37520192-37520214 CACTGTGGGGTGGGGGTGGGAGG - Intronic
1054356967 9:64071194-64071216 CAGTGAGGGCTGGTGGGGGAAGG + Intergenic
1056679153 9:88701927-88701949 GAGGGTGGCCTGGGGGTGGGGGG + Intergenic
1056928396 9:90854154-90854176 CAGACTGGCCGGGTGGTGGAGGG + Intronic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057638512 9:96795029-96795051 TAGTATGGCATGGGGGTGGGTGG + Intergenic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1057810876 9:98255753-98255775 GGGCGTGGCCTGGCGGTGGAGGG - Intergenic
1058975979 9:110126074-110126096 CAGGGTGGCCTGGGGGAATATGG + Intronic
1059172279 9:112136981-112137003 CAGTGTGCCCTGGAGATGGGAGG - Intronic
1059682844 9:116603403-116603425 CAGTGTGGCCCAGGAGTGGGTGG + Intronic
1059735117 9:117092867-117092889 CAGGCAGGCCTGGGGGTGTAGGG + Intronic
1059778538 9:117501659-117501681 CATTGGGACCTGAGGGTGGAGGG - Intergenic
1060147391 9:121264770-121264792 CACTGTAACCTGTGGGTGGAGGG - Intronic
1060198203 9:121636641-121636663 CAGCTTGGCCTGTGGGTGCATGG + Intronic
1060536558 9:124393933-124393955 CGGTGTGGCCTCGTGGTGCAGGG - Intronic
1060826354 9:126690301-126690323 CTGTGTGGGCTGGGGTTTGAAGG + Intronic
1060867946 9:127014676-127014698 CAGGGAGGCCTGGGGGTGGGGGG + Intronic
1060927100 9:127462660-127462682 CAGTGAGGCCTGTCGGAGGAGGG + Intronic
1061224756 9:129274703-129274725 GAGTGTTGCCAGGGGCTGGAGGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061900743 9:133670840-133670862 GAGTGTGGCTAGGGGCTGGAGGG - Intronic
1062094108 9:134694296-134694318 CTGTGCGGCCTGGGCGGGGACGG - Intronic
1062113841 9:134797007-134797029 CACAGTGGCCGGTGGGTGGAGGG + Intronic
1062198296 9:135286872-135286894 GAGGGAGGCCTGGGGGAGGATGG - Intergenic
1062564882 9:137159878-137159900 CAGGGAGGCGTGGGGGTGGTGGG - Intronic
1062623514 9:137433143-137433165 AAGTGGGCCCTGTGGGTGGAGGG - Intronic
1203561214 Un_KI270744v1:60087-60109 CAGTGAGGGCTGGTGGGGGAAGG - Intergenic
1185596245 X:1308684-1308706 GAGGCTGGCGTGGGGGTGGAAGG - Intronic
1185847108 X:3447864-3447886 CAGTGTGGCCTCGTAGGGGAAGG + Intergenic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1188821094 X:34775978-34776000 CAGTGAGGCCTGTCGGGGGATGG - Intergenic
1188923762 X:36012649-36012671 CAGTGGGGCCTGTTGGTGGTTGG + Intergenic
1190569643 X:51768334-51768356 CAGTGAGGCCAGGAGGTGGTGGG + Intergenic
1192212699 X:69137702-69137724 CAGCCTGGGGTGGGGGTGGAAGG - Intergenic
1192410746 X:70930533-70930555 CAGTGTGGGCTTGGTGAGGAGGG - Intronic
1192589840 X:72350827-72350849 CATTCTGGCCTCGGGGTAGAGGG - Intronic
1193449445 X:81647437-81647459 CAATGTGGCCTGGGGTGTGAGGG + Intergenic
1193708098 X:84847196-84847218 CAGGGTGGGCTGTGGGTGGAGGG + Intergenic
1196814668 X:119655350-119655372 CACTGGGGCCTGGGGGTGGAGGG - Intronic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1199606925 X:149585470-149585492 AAGTGTGTGTTGGGGGTGGAGGG + Intronic
1199632198 X:149783898-149783920 AAGTGTGTGTTGGGGGTGGAGGG - Intronic
1199892727 X:152102893-152102915 CACTGTGGCCTGTTGGGGGAAGG - Intergenic
1200213688 X:154358129-154358151 GAGTGTGGGCTGCGGGTGGCTGG - Intronic
1200373571 X:155755407-155755429 TAGTGTGGCATGGGAGTTGAGGG + Intergenic
1200967336 Y:9109185-9109207 AGGTGTGGCCTTGTGGTGGATGG - Intergenic
1201670611 Y:16516162-16516184 CACTGTAGCCTGGCGGGGGAAGG - Intergenic
1201722815 Y:17120260-17120282 CAATGTGTCCTGGGAGTAGACGG + Intergenic