ID: 1153806470

View in Genome Browser
Species Human (GRCh38)
Location 18:8712519-8712541
Sequence AAGAGAAAGGAGGAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3276
Summary {0: 1, 1: 1, 2: 56, 3: 455, 4: 2763}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153806470_1153806478 -5 Left 1153806470 18:8712519-8712541 CCCGCCTCCTCCTCCTTTCTCTT 0: 1
1: 1
2: 56
3: 455
4: 2763
Right 1153806478 18:8712537-8712559 CTCTTTCAGAAGGGTTAACATGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153806470 Original CRISPR AAGAGAAAGGAGGAGGAGGC GGG (reversed) Intronic
Too many off-targets to display for this crispr