ID: 1153809494

View in Genome Browser
Species Human (GRCh38)
Location 18:8739475-8739497
Sequence GAAGAATCCTAGGCAGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153809494 Original CRISPR GAAGAATCCTAGGCAGTGTA GGG (reversed) Intronic
902148976 1:14426898-14426920 GAAGAATCCAAGGATGTGAAAGG - Intergenic
904206381 1:28858083-28858105 GAAAAATCCTAGGCCGGGTGTGG - Intronic
905344144 1:37300106-37300128 GAGGAATCCTTGGCAATGTTGGG - Intergenic
906931017 1:50169432-50169454 GAAGAAGGAAAGGCAGTGTAGGG - Intronic
916314222 1:163429466-163429488 GAAGAATCTAAGAAAGTGTAAGG - Intergenic
916697082 1:167249387-167249409 GAAACTTGCTAGGCAGTGTAGGG + Intronic
918115698 1:181495365-181495387 GAAAAATCCAAGGCACTGCAAGG - Intronic
923429801 1:233909145-233909167 AAAGAATCCTAGGCTGGGTGCGG - Intronic
1064464569 10:15566518-15566540 GAAAAATCCTAGGCCGGGCATGG + Intronic
1065783592 10:29192851-29192873 AAAGAATCCTTGGCCGGGTATGG + Intergenic
1068351076 10:55845925-55845947 GCAGCCTCCTAGGCAGTGTGTGG - Intergenic
1069241035 10:66139409-66139431 GAAAAATCCAAGGCAGTACATGG - Intronic
1072846828 10:98840877-98840899 GAATAATCCAATGCTGTGTATGG - Intronic
1073513538 10:104057633-104057655 GTATAATTCTAGGCACTGTAAGG - Intronic
1075118393 10:119646392-119646414 AAAGAATTCTAGGCAGAGAAGGG + Intergenic
1083655682 11:64228296-64228318 GAAGAATCCTTGGCGGGGCAAGG - Intronic
1085058453 11:73422803-73422825 AAAGAACCCTTGGCAGTGAAGGG + Intronic
1086763434 11:90663698-90663720 GGAAAATGCTAGGCTGTGTAAGG + Intergenic
1088908379 11:114171666-114171688 GCAGAATTCTAGGCTGTGCAGGG - Intronic
1089940013 11:122406581-122406603 GAAGAAGAATAGACAGTGTAGGG - Intergenic
1091849790 12:3686444-3686466 CAAGAATTCTGGGCAGTGTTGGG + Intronic
1092966622 12:13650034-13650056 GAAGGAGCCTGGGCAGTGCAGGG - Intronic
1093244632 12:16721355-16721377 GAAGAATCTTAGGCCGGGCATGG + Intergenic
1098941778 12:76545640-76545662 GAAGCATCCTGGGCAGAGTTAGG - Intronic
1104089635 12:125504832-125504854 GAAGAACCAGAGGCAGTGTTTGG + Intronic
1104397499 12:128447040-128447062 GAAGCATACTGGGCAGTGCATGG + Intronic
1105506278 13:21013039-21013061 GAGGAATACCAAGCAGTGTAAGG + Intronic
1107422343 13:40259760-40259782 GAAGATGTCTATGCAGTGTATGG + Intergenic
1109980883 13:69904846-69904868 GAAGATTCCAAGGCAGTTAAAGG - Intronic
1119440062 14:74622149-74622171 GAAGCATCTCAGGCAGTGAAAGG - Intergenic
1123587742 15:21774114-21774136 AAAGAATCCTTGTCAGTCTACGG + Intergenic
1123624380 15:22216679-22216701 AAAGAATCCTTGTCAGTCTACGG + Intergenic
1127076423 15:55331014-55331036 GCAGAATCCAAGGCAGTTTTGGG + Intronic
1131180400 15:90235163-90235185 GTAGATTCCTAGGCAGTCTAGGG - Intronic
1137876879 16:52005665-52005687 GAAGGAGCCATGGCAGTGTAAGG - Intronic
1139662878 16:68433717-68433739 GAAGAAGCCCAGGCTGTGTGGGG + Intronic
1141944883 16:87303200-87303222 GAGGAATCCCAGGCAGGGAAGGG + Intronic
1142423642 16:89988906-89988928 GAAGAATCCCAAGCAGTATCAGG + Intergenic
1144140614 17:12343656-12343678 GAAGAATCAGAGTCAGGGTAGGG - Intergenic
1148679865 17:49467362-49467384 GGAGACTCCCAGGCAGTGAATGG - Intronic
1151455685 17:74224511-74224533 GAAGAATTATCTGCAGTGTAGGG + Intronic
1152092131 17:78252861-78252883 GAAGCATCCCAGGCAGGGAAGGG - Intergenic
1153809494 18:8739475-8739497 GAAGAATCCTAGGCAGTGTAGGG - Intronic
1155789272 18:29945013-29945035 GAAGAAGACTAGGTAATGTAGGG - Intergenic
1155885684 18:31205519-31205541 GAAGAATGCCAGACAGTGTTAGG - Intergenic
1156078000 18:33303911-33303933 GAAGCATCCTATGCAGTTCATGG + Intronic
1156200116 18:34821385-34821407 GAAGAATCATAGCCTGTGCAGGG + Intronic
1157787135 18:50494067-50494089 AAAGAATCCTAGGCTGGGTGTGG - Intergenic
1158347893 18:56534188-56534210 GGACAATCCCAGGCAGTGCAAGG + Intergenic
1161410484 19:4114268-4114290 GAAGAAACCGAGGCTGTGTGGGG - Intronic
925042374 2:741760-741782 AAAGAATCATTGGCAGTCTAGGG + Intergenic
926515478 2:13840174-13840196 GGAGAACCCTAAGCAGTGTGGGG + Intergenic
926745859 2:16157361-16157383 GAAGAATCAGAGGCAGGGTGAGG + Intergenic
928398447 2:30960923-30960945 GAACAATCCCAGGCAGAGTGAGG - Intronic
929468062 2:42163816-42163838 GCAGAAACCCAGGCAGTGTAGGG + Intergenic
932146209 2:69319724-69319746 GTAGAAACCTAGGAAGTGTTGGG - Intergenic
937230484 2:120395683-120395705 GCAGAATCCCAGGAAGTGAAAGG - Intergenic
941855258 2:170224377-170224399 GAAGAAACCAAGGCAGGGAAAGG + Intronic
943390942 2:187267195-187267217 GAAGGATTCTAGGCAGTGACAGG + Intergenic
946530448 2:220564487-220564509 AAAGCAGCCTAGGCAGTGTCAGG - Intergenic
1170406965 20:16048491-16048513 CAAGGAGACTAGGCAGTGTAGGG + Intronic
1171051370 20:21862367-21862389 GGAGAATCCTAGGCAGAGTCTGG + Intergenic
1173103969 20:40114352-40114374 TAAGAGTCCCAGACAGTGTATGG + Intergenic
1173860614 20:46280869-46280891 GGATAATTCTAGGCAGTGTCTGG + Intronic
1178753527 21:35326314-35326336 GAAGAATCATGGGCAGTGTGGGG + Intronic
1182568324 22:31216364-31216386 GAAGATTCATAGGAAGTGGAAGG + Intronic
1184977251 22:48071146-48071168 AAAGAATCCCAGGTATTGTATGG + Intergenic
952321600 3:32282956-32282978 GAAAAATACTAGGCAGGCTAAGG - Intronic
953594537 3:44297622-44297644 GATAAATCTTAGCCAGTGTAAGG + Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955458653 3:59154565-59154587 GAAGAATCCTCAGAAGTGGAAGG + Intergenic
960310837 3:116114363-116114385 GAGCAATCCTAGGCAGTACATGG + Intronic
961764363 3:129197483-129197505 GAAGAACCCTAGGGAGTGCAGGG + Intergenic
961958656 3:130830891-130830913 GTACAATCCTAGGCAGTGCTGGG + Intergenic
964968822 3:162534090-162534112 GAAGAAACTAAGGCAGTGGAGGG - Intergenic
966530506 3:180973505-180973527 GAACAATTCTAGCCAGTGTGGGG - Intronic
966710503 3:182967706-182967728 GAAGAATCCTAGACACTTGAGGG - Intronic
969268448 4:6081550-6081572 GAAGAATCCCAGACAGAGAAGGG + Intronic
970369683 4:15394392-15394414 GCAGAATGCTAGGCAGAGAAAGG + Intronic
971792133 4:31183495-31183517 GAAGAATCCCATACAGTATATGG - Intergenic
972143956 4:35998177-35998199 GGGGAATCCTAGGCAATGTTTGG + Intronic
974464320 4:62234315-62234337 AAAGAATATTAAGCAGTGTAAGG - Intergenic
976540438 4:86268231-86268253 GAAGAATCCTATGTGGAGTATGG - Intronic
977136189 4:93307521-93307543 GAAGAATCATAGACAATGAAAGG - Intronic
988607520 5:32692034-32692056 GAAGAATCCTATGGAATGAAAGG + Intronic
990828596 5:59930695-59930717 GAAGAAAACCAGGCAGAGTAGGG + Intronic
991134677 5:63167444-63167466 GGAGAATACTAGACAATGTAAGG - Intergenic
992123376 5:73616781-73616803 GTAGATTCCTAGTCTGTGTATGG - Intergenic
995941775 5:117594353-117594375 GAATAAGCCTTGGCAGTGTTTGG - Intergenic
1000904906 5:166953327-166953349 AAAGAATCCTAGGGAGATTAAGG - Intergenic
1004415393 6:15418737-15418759 AAAGAATCATTGGAAGTGTATGG + Intronic
1011177209 6:84577020-84577042 GAACAGTCCCAGGCAGTGAAAGG - Intergenic
1011231759 6:85169726-85169748 GCAGAATTCTAGACAGTTTAAGG - Intergenic
1012793170 6:103726387-103726409 GAAGAGTAGTAGGGAGTGTAGGG - Intergenic
1014786388 6:125624482-125624504 GAAGAATCCGAGGAAGTGTGAGG - Intergenic
1015661008 6:135573620-135573642 GTAGAATACAAGGCAGTGTGAGG - Intergenic
1017983202 6:159420790-159420812 CAAGAATCCAAGGAAGAGTAGGG + Intergenic
1018242281 6:161789420-161789442 GAAGAATCCTAGGCTACGCAAGG - Intronic
1021336640 7:19411085-19411107 GAAGAATCCTACACAGTCTGTGG + Intergenic
1023654891 7:42409478-42409500 GAAGAACCCTCTGCAGTGTAGGG + Intergenic
1031503154 7:122546790-122546812 GAAGAGTCCTAGACTGTATACGG - Intronic
1037862076 8:22412434-22412456 GAAGAAACAGAGGCAGTGTGAGG - Intronic
1038529776 8:28308961-28308983 GCAGAAGCCTTGGCAGGGTAGGG + Intergenic
1044644230 8:94421070-94421092 GAAGAAGCAGAGGCAGTGTGGGG - Intronic
1048526652 8:135208897-135208919 GAGGACTCCTAGGCAGGGTGAGG + Intergenic
1050693865 9:8258418-8258440 AAAGAATACTGGGCTGTGTATGG + Intergenic
1055752107 9:79517992-79518014 TATGAATGCTGGGCAGTGTAGGG - Intergenic
1060675864 9:125514068-125514090 GAAGAAGCCAAGGCTGTGTGGGG - Intronic
1062036697 9:134385654-134385676 GAAGAAGCCCAGGCATTGTTCGG - Intronic
1186074549 X:5863780-5863802 GAACAATCTTAGGCAGTGTCTGG + Intronic
1186510213 X:10124923-10124945 GCAGAATCCCAGGCAGTGGATGG + Intronic
1186900619 X:14051431-14051453 GTAGAAACCTTGGCAGAGTATGG + Intergenic
1189616901 X:42793545-42793567 GGAAAATCCAAGGCAGTTTATGG + Intergenic
1192315843 X:70050843-70050865 GAAGAATACTAGGCTGGGCATGG + Intergenic
1195405740 X:104511328-104511350 GAACAATGCTAGGCAGAGAATGG + Intergenic
1198083449 X:133261450-133261472 GAAGAAGCCTAGGCATGGCAGGG + Intergenic
1199804272 X:151282309-151282331 CAAGAATCCCAGGCAGGGTGTGG - Intergenic
1200470351 Y:3579002-3579024 GAAGAACTCCAGGAAGTGTAGGG + Intergenic