ID: 1153811208

View in Genome Browser
Species Human (GRCh38)
Location 18:8753505-8753527
Sequence GCCCATTGGGTCATGCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153811208_1153811216 26 Left 1153811208 18:8753505-8753527 CCAGTAAGCATGACCCAATGGGC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1153811216 18:8753554-8753576 CCAGCTCTGCCCTGACTCCCTGG 0: 2
1: 1
2: 4
3: 100
4: 628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153811208 Original CRISPR GCCCATTGGGTCATGCTTAC TGG (reversed) Intronic
900713315 1:4128738-4128760 GCCCCAGGGATCATGCTTACAGG + Intergenic
912632219 1:111255607-111255629 GTCCACTGGGTCTTGCTTTCTGG - Intergenic
922314489 1:224430901-224430923 GACCATTTGGCCCTGCTTACTGG - Intronic
1063908928 10:10810479-10810501 CCCCATTGGGGGATGCTTAAGGG - Intergenic
1089195110 11:116689725-116689747 GCCCATTGGGTCATTCATAAGGG - Intergenic
1097267384 12:57754301-57754323 GCTCATTGGGTCAAACATACTGG - Intronic
1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG + Intergenic
1115237114 14:31218260-31218282 GCCCATTGTCTCAGGCTTACTGG + Intergenic
1120616297 14:86709404-86709426 ACCCATTGGCTCGTGCTTAAAGG - Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1122792294 14:104189132-104189154 GCCCGTTGGGTAAAGCTAACAGG - Intergenic
1129170909 15:73807334-73807356 GCCCATTGGTCCATTCTTCCAGG + Intergenic
1130577545 15:85105803-85105825 GCCCAGGGCCTCATGCTTACTGG - Intronic
1132023394 15:98384030-98384052 GGGCATTTGGTCATGCTTCCTGG + Intergenic
1135532354 16:23265492-23265514 GCCCAATGGCTCATGCCTCCTGG - Intergenic
1153811208 18:8753505-8753527 GCCCATTGGGTCATGCTTACTGG - Intronic
1164774501 19:30842416-30842438 GCCCCTGGGGTCATGCTGTCAGG - Intergenic
1167692136 19:50992199-50992221 GCCCATTGTTTCATACTTCCTGG + Intergenic
925613300 2:5721503-5721525 GCCCATAGAGTCATACTTCCTGG - Intergenic
931171784 2:59811131-59811153 CCACATTGGTTCATGCTTGCTGG + Intergenic
936238422 2:110766693-110766715 TCCCATTGGGTCCTGCTGATGGG + Intronic
940377063 2:152968955-152968977 GCCCAGTTGTTCATCCTTACAGG + Intergenic
948229810 2:236341678-236341700 GCCCATTGGGTCAGCCCTCCTGG - Intronic
1172840992 20:37902849-37902871 GCCCGTTGGGTCGTGCTTTGCGG + Intergenic
1178617506 21:34146634-34146656 GCCCATTTTGGCCTGCTTACAGG + Intergenic
953173142 3:40525349-40525371 TCCCAGTGGGTGATGCTGACCGG - Intronic
953868110 3:46601723-46601745 TCCCATTGGGGCATCCTCACAGG - Intronic
962235263 3:133701597-133701619 GCCAAGTGGGACATGCTTCCTGG + Intergenic
970247581 4:14079378-14079400 GCCAATTGGGTCATACATCCTGG - Intergenic
983306842 4:166000595-166000617 CCCTATTGAGTCATTCTTACTGG - Intronic
991051000 5:62272775-62272797 GGCGATGGGGGCATGCTTACTGG - Intergenic
998256325 5:140591531-140591553 GAGCTTGGGGTCATGCTTACAGG - Intronic
1001531243 5:172463334-172463356 GCCCATTGGGTCCTCCTGCCTGG - Intergenic
1029184747 7:98730490-98730512 GCTCATGGGGTCAGGCTTCCGGG + Intergenic
1036405941 8:8455368-8455390 GCCCTGTGGGTCCTGCTTATTGG - Intergenic
1040490926 8:47921561-47921583 GAGCCTTGGGTCATGCTAACAGG + Intronic
1041355995 8:57000929-57000951 TCCCGTTGGGTCATTCATACTGG + Intergenic
1048461096 8:134622667-134622689 GCCCATTGTGTGGTCCTTACTGG - Intronic
1052379011 9:27750026-27750048 GCCTATTGTGTCATGCTCACTGG + Intergenic
1192238266 X:69309921-69309943 GCCTATTGGATCATGGTGACTGG + Intergenic