ID: 1153812406

View in Genome Browser
Species Human (GRCh38)
Location 18:8763489-8763511
Sequence GAGTGTGACACAAGCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153812406_1153812413 28 Left 1153812406 18:8763489-8763511 CCAGCCCAGCTTGTGTCACACTC 0: 1
1: 0
2: 1
3: 16
4: 229
Right 1153812413 18:8763540-8763562 CCAAAGCTCTTGTATGGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1153812406_1153812410 22 Left 1153812406 18:8763489-8763511 CCAGCCCAGCTTGTGTCACACTC 0: 1
1: 0
2: 1
3: 16
4: 229
Right 1153812410 18:8763534-8763556 CTAAACCCAAAGCTCTTGTATGG 0: 1
1: 0
2: 2
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153812406 Original CRISPR GAGTGTGACACAAGCTGGGC TGG (reversed) Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900336590 1:2166996-2167018 CTGCGTGACACAAGCTGAGCTGG - Intronic
900943159 1:5814246-5814268 GAGTGTGACAAAAGCCACGCCGG - Intergenic
902170002 1:14602311-14602333 GAGGGAGAGACAAGATGGGCTGG - Intronic
904917834 1:33983099-33983121 GAGTGTCTGAGAAGCTGGGCTGG - Intronic
904918626 1:33988344-33988366 GAGTGTCTGAGAAGCTGGGCTGG + Intronic
906660428 1:47577946-47577968 GAGTGGGTCAGAAGCTGGGGAGG - Intergenic
907179221 1:52554284-52554306 GAGTTTGACACATGCTAGGCAGG + Intergenic
907438730 1:54465407-54465429 GAGAGTGGGAGAAGCTGGGCTGG - Intergenic
907937324 1:59054209-59054231 GAGTGTGATAAATGCTGCGCTGG + Intergenic
910877778 1:91893575-91893597 GAATGTGTTACAAGTTGGGCTGG - Intronic
912871455 1:113310779-113310801 TAGTGAGACACAACCTGGGGTGG + Intergenic
913196559 1:116461077-116461099 GAGAGAGACACAAGCAGGGCGGG - Intergenic
914704620 1:150160592-150160614 GTGTGTGATGCAAGCTGGGTAGG + Intronic
915596333 1:156898372-156898394 GAGTGCGCCAGAGGCTGGGCGGG - Intronic
916321744 1:163512523-163512545 TAGTGAGACACCAGCTGGGAAGG + Intergenic
916996161 1:170303436-170303458 GAGGGTGCCTCAAGCTGGCCAGG - Intergenic
917161712 1:172064473-172064495 AAGGGTGACACAAACTGAGCAGG + Intronic
920557978 1:206918199-206918221 GGGTGTGTTTCAAGCTGGGCTGG - Intronic
920565342 1:206968637-206968659 GTTTGTGACACAGGCTGTGCAGG + Intronic
920774296 1:208921131-208921153 ACCTGTGTCACAAGCTGGGCAGG + Intergenic
920976974 1:210795449-210795471 GAGTGGGATAGAAACTGGGCGGG - Intronic
923497962 1:234541237-234541259 GTGTATCACACAAGGTGGGCTGG - Intergenic
923661169 1:235958589-235958611 TAGTCAGACACAAGCAGGGCAGG - Intergenic
1063270540 10:4505640-4505662 GAGTGTGACACACACTGAACAGG - Intergenic
1064280335 10:13945661-13945683 GTGTGTTATATAAGCTGGGCTGG + Intronic
1064373977 10:14779080-14779102 GAGGCTGACACCTGCTGGGCTGG - Intergenic
1065553107 10:26888688-26888710 GAGGGTGACAGCACCTGGGCTGG + Intergenic
1066649787 10:37643357-37643379 TAGTGAGGCACCAGCTGGGCTGG - Intergenic
1067032677 10:42888902-42888924 TAGTGAGGCACCAGCTGGGCTGG - Intergenic
1067111357 10:43403300-43403322 GAAAATGACACAGGCTGGGCGGG - Intronic
1070167156 10:73907448-73907470 GAGTGAGGCACAGGCTGGACAGG + Intergenic
1070806566 10:79274404-79274426 CAGAGTGACACCAGCTGGGCGGG - Intronic
1071046616 10:81387130-81387152 GGGAGGGACACAAGCTTGGCTGG - Intergenic
1071224975 10:83518802-83518824 TAGTGAGACACAAACAGGGCAGG + Intergenic
1074283737 10:112078828-112078850 CAGTGGAACACAAGCTGTGCAGG + Intergenic
1075557464 10:123444009-123444031 GAGTGTGGCAGGAGCTGTGCAGG - Intergenic
1076859772 10:133135356-133135378 GGGTGTGAGACAGCCTGGGCTGG + Intergenic
1077620365 11:3716498-3716520 GAGTTTGAGACCGGCTGGGCAGG + Intronic
1078690815 11:13579016-13579038 TAGTGAGACACAAGCTAGGGTGG + Intergenic
1079063566 11:17270802-17270824 GAGTGTAACACGGGCAGGGCAGG - Intronic
1081098114 11:38966159-38966181 GAGTATGATACATGATGGGCAGG - Intergenic
1081594354 11:44448916-44448938 GAGAGTGACAGAGGCTGGGAGGG + Intergenic
1082672515 11:56053064-56053086 GAGTTTGAGACAAGCCTGGCCGG + Intergenic
1083656003 11:64230112-64230134 GAGGGGGACACAGGCTGGGCGGG - Intronic
1084673095 11:70619095-70619117 TAGAGTGTCACAGGCTGGGCTGG - Intronic
1084909099 11:72373141-72373163 GAGTGGGGCAGAAGCTGGGTTGG - Intronic
1085016286 11:73176213-73176235 GGGTCTGACACCACCTGGGCAGG - Intergenic
1085194810 11:74662673-74662695 TAGTGAGACACCAGCTGGGTTGG - Intronic
1086410230 11:86537804-86537826 GAGTGCTCCACAAGCTGTGCAGG + Intronic
1086878062 11:92121586-92121608 GAGTTTGAAAGAAGCTGGGCAGG + Intergenic
1087793192 11:102428934-102428956 GAGTGGAACAGGAGCTGGGCAGG - Intronic
1089256671 11:117197856-117197878 GAGGGTGATGAAAGCTGGGCAGG + Intergenic
1089578255 11:119461930-119461952 GACAGTGACACAAGCTTGGCTGG + Intergenic
1091146866 11:133287755-133287777 GTGTGAGACTCAAGCAGGGCTGG + Intronic
1091389354 12:116606-116628 GAGTCTGACTGCAGCTGGGCTGG - Intronic
1094488388 12:30942963-30942985 CAGTGAGGCACAGGCTGGGCTGG - Intronic
1096412092 12:51384302-51384324 CAGTTTGATACAAGCTGGGCTGG - Intronic
1096598833 12:52715012-52715034 GAGTGAGAAATAAGCTGGACGGG + Intergenic
1097709019 12:62898034-62898056 GACTGTTCCCCAAGCTGGGCTGG - Intronic
1098044977 12:66391079-66391101 GAGAGTGACACAACATAGGCAGG + Intronic
1100430421 12:94527670-94527692 GAGTTTGAGACCAGCTTGGCCGG - Intergenic
1102468915 12:113148474-113148496 CTGTGTTACACAGGCTGGGCTGG + Intergenic
1102976648 12:117211571-117211593 GAGGGTGAGAAAAGGTGGGCTGG - Exonic
1106756652 13:32828814-32828836 GAGAGTGACACCAGTTGGGTGGG + Intergenic
1107524124 13:41213593-41213615 GAGACGGACACAAGCTTGGCTGG - Intergenic
1109123599 13:58489031-58489053 GAGTGGGACCCAGGCTAGGCGGG + Intergenic
1112147092 13:96711780-96711802 GAGTGTGACACAAAATGTACTGG - Intronic
1113294307 13:108941115-108941137 GAGTGAGACACAGGCTGGAAAGG + Intronic
1113638316 13:111937629-111937651 GAGAGTGGCAAAAACTGGGCAGG - Intergenic
1114555261 14:23558548-23558570 GTGTGTTACAGAAGCTGGGTGGG + Intronic
1115506424 14:34098149-34098171 GGGTGTGACACTGTCTGGGCTGG - Intronic
1115930130 14:38482150-38482172 CAGTGAGACACCAGCTGGGATGG + Intergenic
1117211359 14:53503776-53503798 GAGTGTGATAGGAGATGGGCAGG + Intergenic
1117219621 14:53589937-53589959 GAGAGTGAAACAAGATGTGCTGG + Intergenic
1117504499 14:56388800-56388822 TAGTGAGACACCAGCTGGGAGGG - Intergenic
1119660101 14:76444965-76444987 CTTTGTTACACAAGCTGGGCTGG - Intronic
1123972075 15:25516555-25516577 GATTGTAACACAAGCTGGAAGGG + Intergenic
1124382210 15:29176588-29176610 AAGTGTGGCACATGCAGGGCAGG + Intronic
1126053231 15:44706811-44706833 GAGAGGGACATAAGCTTGGCTGG - Intronic
1126053403 15:44707725-44707747 TAGTGAGACACTAGCTGGGATGG - Intronic
1127983962 15:64054098-64054120 AAGTGTGGAACAAGATGGGCAGG + Intronic
1130367404 15:83252923-83252945 GAGTTTGGGACAAGTTGGGCTGG + Intergenic
1132745736 16:1435470-1435492 GAGGCTGAGACAAGCTGGGGTGG + Intronic
1133028873 16:3000401-3000423 GAGGGTGTCAGAGGCTGGGCTGG - Intergenic
1134810501 16:17163218-17163240 AAGTCTGACACCAGCTGGGAAGG - Intronic
1135201982 16:20445428-20445450 TAGTGTGCCACAAACTGTGCAGG - Intergenic
1135217122 16:20582438-20582460 TAGTGTGCCACAAACTGTGCAGG + Intergenic
1135569069 16:23534543-23534565 CAGTGTGACAGGTGCTGGGCTGG + Intronic
1136280941 16:29210848-29210870 GAGTGAGCCAGAAGCTGCGCTGG - Intergenic
1136933327 16:34437214-34437236 GGGTGTGTGAGAAGCTGGGCGGG + Intergenic
1136971245 16:34974600-34974622 GGGTGTGTGAGAAGCTGGGCGGG - Intergenic
1137557867 16:49484054-49484076 GACCTTGACCCAAGCTGGGCTGG + Intergenic
1139878709 16:70166526-70166548 GCTTGTGACAGGAGCTGGGCTGG + Intergenic
1140358854 16:74328287-74328309 GCTTGTGACAGGAGCTGGGCTGG - Intergenic
1140373807 16:74428966-74428988 GCTTGTGACAGGAGCTGGGCTGG - Intergenic
1140869134 16:79090700-79090722 GAGTGAGGCACATGCTCGGCGGG + Intronic
1140909369 16:79437889-79437911 GAGTGGGACACAGGCCAGGCGGG + Intergenic
1141233238 16:82190860-82190882 GGCTGTGTCACAATCTGGGCTGG - Intergenic
1141500151 16:84438516-84438538 GCGTGTGACCCAAGCTGAGCTGG - Intronic
1142085299 16:88176771-88176793 GAGTGAGCCAGAAGCTGCGCTGG - Intergenic
1143419931 17:6780864-6780886 GAGTGTGCCGGAAGGTGGGCAGG - Exonic
1144417893 17:15069205-15069227 GAGATTGACACAAGGTGGGGAGG + Intergenic
1144816736 17:18040043-18040065 GTGTGAGACACAGGCTGGGAAGG - Intronic
1145749830 17:27347480-27347502 GAGTTTGAGACCAGCCGGGCAGG + Intergenic
1145953879 17:28841350-28841372 TAGTTTGAGACAAGCTGGGAGGG - Intronic
1150103952 17:62448055-62448077 GAGGGTGAAACAGGCTGGACTGG - Intronic
1150192664 17:63259321-63259343 TAGTGAGACACCAGCTGGGGTGG - Intronic
1151508001 17:74541926-74541948 GACTGTGACACAGGAAGGGCAGG + Intronic
1153183377 18:2460426-2460448 TAGTGAGACACAAGCTAGGGTGG - Intergenic
1153812406 18:8763489-8763511 GAGTGTGACACAAGCTGGGCTGG - Intronic
1154011902 18:10581391-10581413 GAATGTTACAGCAGCTGGGCAGG + Intergenic
1156465603 18:37346392-37346414 GAGTGTGACAGAGGCAGGGCAGG + Intronic
1158088391 18:53681672-53681694 GCATGTGACTCAATCTGGGCAGG - Intergenic
1159490609 18:69129212-69129234 TAGTGAGACACCAGCTGGGGTGG - Intergenic
1161164566 19:2779301-2779323 GCCTGTGTCACATGCTGGGCAGG - Intronic
1162596076 19:11630296-11630318 TAGTGAGACACTAGCTGGGGTGG + Intergenic
1163577921 19:18121606-18121628 GAGTGTGATTTAGGCTGGGCAGG + Intronic
1165027797 19:32974365-32974387 GAGTGTGTGACAAGCTGAGCTGG - Intronic
1166887755 19:45972356-45972378 GTGTGTGACACAGGCGTGGCTGG - Intronic
925288321 2:2730216-2730238 GAGTGTGCCAGCAGCTGGACGGG - Intergenic
928864060 2:35896031-35896053 TAGTGAGACACCAGCTGGGGTGG - Intergenic
929056514 2:37881610-37881632 GAGTGTGACAGCAGGTGAGCAGG - Intergenic
929278113 2:40047317-40047339 GAGTATGATACAAGCAGGGATGG + Intergenic
931572199 2:63680691-63680713 CAGTGTGACACCAGCTGGGGTGG + Intronic
931600769 2:64000934-64000956 GAGAAGGACAGAAGCTGGGCTGG - Intronic
931691996 2:64841843-64841865 GAGTGTTCTACATGCTGGGCTGG + Intergenic
933804486 2:85988307-85988329 GAGAGTGAGACAAGCAGAGCAGG - Intergenic
934555268 2:95283832-95283854 GAGGGTCACACATGGTGGGCAGG - Intronic
934573470 2:95385812-95385834 CAGAGTGACACCAGCTGGGAGGG - Exonic
934613013 2:95754713-95754735 GAGTTTGGCAGAAGCAGGGCCGG - Intergenic
934647891 2:96069709-96069731 GAGTCTGTCAGAAGCAGGGCGGG + Intergenic
934841263 2:97625530-97625552 GAGTCTGTCAGAAGCAGGGCGGG + Intergenic
935646285 2:105337786-105337808 GAGAGTGACACAAACCCGGCGGG - Intronic
936065597 2:109329739-109329761 GAGTGTGACACAAAGGAGGCTGG + Intronic
936269723 2:111040613-111040635 GGAAGAGACACAAGCTGGGCAGG + Intronic
937985846 2:127637751-127637773 GGGTGTGGCACAAGGTGGACAGG + Intergenic
940379168 2:152994458-152994480 AAGTTTGACACAAGCTGAGGAGG + Intergenic
941678692 2:168371683-168371705 GAGAGAGACTCAAGCTTGGCTGG + Intergenic
942490582 2:176485740-176485762 CAGTGAGACAGATGCTGGGCAGG + Intergenic
942574544 2:177349525-177349547 GTGTGTGACACAAGATCAGCTGG + Intronic
942574560 2:177349733-177349755 GTGTGTGACACAAGATCAGCTGG + Intronic
942972333 2:181971561-181971583 TAGTGAGACACCAGCTGGGGTGG - Intronic
944532156 2:200677862-200677884 GAGTGTGCGACATGCAGGGCGGG - Intergenic
945625970 2:212206226-212206248 GGATCTGACACAAGCTGGGGAGG + Intronic
946311300 2:218883803-218883825 GCGTGTGGCCCGAGCTGGGCAGG - Intronic
948617839 2:239212862-239212884 GAGTCTCTAACAAGCTGGGCGGG - Intronic
949055008 2:241922700-241922722 AAGTGTGAGACAGGCAGGGCAGG + Intergenic
1172510176 20:35495237-35495259 GAGAGTGGCATGAGCTGGGCAGG + Intronic
1174304611 20:49606110-49606132 GAGTGTGGCAGCAGCTGGGCAGG - Intergenic
1176940013 21:14912334-14912356 TAGTGAGACACCAGCTGGGGAGG - Intergenic
1177592158 21:23184989-23185011 TAGTGAGACACCAGCTGGGGTGG + Intergenic
1177784934 21:25661244-25661266 GAGTTTGAGACTAGCTGGACTGG + Intronic
1178408471 21:32345390-32345412 GGGTGTGAAGCAAGCTGGGCAGG + Exonic
1179503306 21:41823248-41823270 GACTGTGACAGACGCTGGCCTGG + Intronic
1179546193 21:42113724-42113746 GAGTGTGACACTGTCGGGGCTGG + Exonic
1180715378 22:17868480-17868502 GACTGTGGGACACGCTGGGCAGG - Intronic
1182632060 22:31694273-31694295 GAGTTTGAAACCAGCTGGCCAGG - Intronic
1183312317 22:37117233-37117255 CAGTGGGACAGAAGCTTGGCAGG + Intergenic
1183386613 22:37518927-37518949 GAGTGGGCCACGACCTGGGCCGG - Intronic
1183719863 22:39556561-39556583 CAGTGTGACAACATCTGGGCAGG + Intergenic
1184254548 22:43279703-43279725 GGCTGTGACAGAAGCTGGACAGG - Intronic
1184655968 22:45942194-45942216 GGGTGCCACACCAGCTGGGCCGG - Intronic
1185011459 22:48316872-48316894 GAGGGTGGCACAACCCGGGCAGG + Intergenic
1185269838 22:49924359-49924381 GAGTGTGACTCCAGCTGTGTGGG + Exonic
951707117 3:25554501-25554523 TAGTGTGACAAAAACTGGGAAGG + Intronic
952939246 3:38429232-38429254 GAAGGTGACACAAGCAGGGGTGG - Intergenic
956141538 3:66151382-66151404 TAGTGAGACACAACCTGAGCTGG - Intronic
957810540 3:85215574-85215596 GAGTGAGACACCAGCTTGGGTGG - Intronic
959118572 3:102206576-102206598 TAGTGAGACATCAGCTGGGCTGG - Intronic
959866112 3:111272207-111272229 GATTGTGATACCAGATGGGCAGG + Intronic
963674242 3:148288312-148288334 GAGTGTGGCACAGGCAGGGAGGG - Intergenic
964691601 3:159455835-159455857 GGGTGTGAGACATCCTGGGCTGG + Intronic
966302944 3:178498841-178498863 GAGGGTGACACAAGGTGAGGGGG + Intronic
966463570 3:180203893-180203915 GAGAAGGACACAAGCTTGGCTGG + Intergenic
974300968 4:60067007-60067029 GAGCATGACACCAGCTGGGGTGG + Intergenic
979913191 4:126396658-126396680 TAGTGAGACACAAGCTGGGGTGG - Intergenic
981964869 4:150588142-150588164 GAGGGGGCCACAAGCTGAGCTGG + Exonic
982092905 4:151896015-151896037 CAGTGTTTCACAGGCTGGGCTGG + Intergenic
983657893 4:170101347-170101369 CAGTGAGACACCAGCTGGGGTGG + Intergenic
985480892 5:109552-109574 GGGTGACACAGAAGCTGGGCTGG + Intergenic
985631802 5:1017820-1017842 GGGTGTGAGAGATGCTGGGCTGG + Intronic
986416050 5:7529352-7529374 CAGGGTGCAACAAGCTGGGCAGG + Intronic
995049623 5:107687808-107687830 TAGTGAGACACCAGCTGGGATGG + Intergenic
995614592 5:113946767-113946789 GAATGTGACAAAATCTGGCCGGG - Intergenic
996653665 5:125913683-125913705 CAGTGAGACACCAGCTGGGGTGG - Intergenic
998497484 5:142603328-142603350 GAGTGTCACACACTCTGGGGAGG - Intronic
998689441 5:144571076-144571098 TAGTGAGACACCAGCTGGGGTGG - Intergenic
999272166 5:150302856-150302878 GAGGGAGGCACAAGTTGGGCGGG + Exonic
1002052902 5:176581637-176581659 AAGTGTGACTCAAGCTGGAGGGG - Intronic
1002066756 5:176655690-176655712 GAGTTTGAGACCAGCTGGGGCGG + Intronic
1004527569 6:16423619-16423641 GAGGGTGACTTAAGGTGGGCAGG + Intronic
1005037477 6:21570049-21570071 TAGTGAGACACCAGCTGGGGTGG - Intergenic
1007094815 6:39206612-39206634 CACTGGCACACAAGCTGGGCTGG + Intronic
1007775836 6:44223844-44223866 GACCGGGACCCAAGCTGGGCGGG + Exonic
1008192305 6:48475134-48475156 TAGTGAGACACCAGCTGGGGTGG + Intergenic
1011784257 6:90826548-90826570 GAGTGTGAAAGCAGCTGGGAGGG + Intergenic
1016541421 6:145170276-145170298 CAGTGAGACACTAGCTGGGGTGG + Intergenic
1018138756 6:160805880-160805902 GATGGTGACAGAAGCTGGGTAGG + Intergenic
1022140993 7:27492595-27492617 GAGTGTGCAACAAGCTGGCCTGG - Intergenic
1023508459 7:40924457-40924479 GAGTTTGAGACCAGCTGGGTGGG - Intergenic
1025182750 7:56831890-56831912 CAGTGAGGCACATGCTGGGCTGG + Intergenic
1025689176 7:63745084-63745106 CAGTGAGGCACATGCTGGGCTGG - Intergenic
1025912936 7:65841974-65841996 GTGTGAGGCAGAAGCTGGGCCGG - Intergenic
1026318326 7:69246799-69246821 GTCTGTGTCACCAGCTGGGCAGG + Intergenic
1027414281 7:77958564-77958586 GAGTGTGGCACACTCTGGACAGG - Intergenic
1027554666 7:79648365-79648387 GAGTGTGACACACCTTGGGATGG + Intergenic
1028353478 7:89878708-89878730 CAGTGAGATACCAGCTGGGCTGG - Intergenic
1030022577 7:105290627-105290649 GTGTGTTACCCAAGCTGGTCTGG - Intronic
1030723536 7:112898315-112898337 AAGTGTGACACCAGCTGTGGTGG + Intronic
1031721849 7:125186940-125186962 TAGTGAGACACCAGCTGGGATGG + Intergenic
1032033134 7:128501252-128501274 GAGGGTGAGACAGGCTGGACTGG - Intronic
1033308410 7:140241470-140241492 GAGTGTCGCCCAGGCTGGGCTGG + Intergenic
1037295566 8:17396729-17396751 TAGGGAGACACAAGCTGGGGTGG + Intronic
1038029364 8:23623657-23623679 GAGTGTGTGACAAGCTAAGCTGG + Intergenic
1042633424 8:70845328-70845350 GACTGTTACACAAGATGTGCAGG + Intergenic
1045911054 8:107410287-107410309 CAGTGGGACACTAGCTGGGGAGG - Intronic
1046080443 8:109363823-109363845 CAGTGTGACACAAGCAGCGTGGG + Intronic
1046582113 8:116105727-116105749 GAGTGAGACACAGGATGAGCAGG + Intergenic
1048465149 8:134659336-134659358 GAGGGGGACACAAGGTGTGCGGG + Intronic
1049524777 8:143117909-143117931 GAGTGTGACAGAAGCCGTCCAGG - Intergenic
1049709728 8:144058072-144058094 GAGGGTGACGCCAGCTGTGCTGG + Exonic
1049845142 8:144797086-144797108 GAGTGAGGCACAGGCTGGGTAGG - Intergenic
1050072638 9:1832450-1832472 GTGTGTGACAGAGGCTGGGTGGG + Intergenic
1050480149 9:6080308-6080330 AAGAGTGACACAAGCAGGGGAGG - Intergenic
1050480210 9:6080518-6080540 AAGAGTGACACAAGCAGGGGAGG - Intergenic
1056770546 9:89475199-89475221 CAGTGTCACAGAGGCTGGGCAGG + Intronic
1057746424 9:97755752-97755774 GAGTCTGATCCAAGCTGGGAGGG + Intergenic
1058775610 9:108280317-108280339 AAGTGTGACAGAAGCAGGTCTGG + Intergenic
1059347089 9:113636399-113636421 GAGGGTGACAGCAGCAGGGCTGG - Intergenic
1059409699 9:114124287-114124309 GAGAGTGACACAAGCAGGGCTGG - Intergenic
1062452095 9:136620099-136620121 GACTGTGACCCCAGCTGGGTGGG - Intergenic
1186602209 X:11050022-11050044 TAGTGAGACACCAGCTGGGGTGG - Intergenic
1188720806 X:33521019-33521041 CAGTGTGATACAATCTGGACTGG + Intergenic
1188996179 X:36888287-36888309 GAGAATGACACAAGCCTGGCTGG + Intergenic
1190940063 X:55031310-55031332 GACTGTGGCACAAGTTGGGAGGG + Intergenic
1191593278 X:62912698-62912720 TAGTGAGACACCAGCTGGGATGG - Intergenic
1192065363 X:67879572-67879594 TAGTGAGACACAAGCTGGGGTGG + Intergenic
1192438153 X:71155178-71155200 GGGTGAGACACAGGCTGGGTGGG - Intronic
1193169134 X:78315845-78315867 GAGAGGGACACAAGCCTGGCTGG + Intronic
1193569600 X:83126977-83126999 AGATGGGACACAAGCTGGGCTGG - Intergenic
1193984793 X:88227719-88227741 TACTGAGACACAAGCTGGGGTGG + Intergenic
1194884884 X:99301916-99301938 GACTGTGACACAATCTGTGAAGG - Intergenic
1195026052 X:100878746-100878768 GAGTTTGAGACAAGCCTGGCTGG + Intergenic
1197076242 X:122356669-122356691 GAATGTTACAAAAGCTGGGAAGG + Intergenic
1197864165 X:131000356-131000378 CAGTGTGCCACAAAATGGGCTGG - Intergenic
1201972958 Y:19816366-19816388 AAGAGTGACACAAGCAGGGGAGG + Intergenic