ID: 1153812552

View in Genome Browser
Species Human (GRCh38)
Location 18:8764766-8764788
Sequence CTGAGACTTTGTAAGGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153812541_1153812552 29 Left 1153812541 18:8764714-8764736 CCTTTCCCTTTTACCCACGTAGC 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1153812552 18:8764766-8764788 CTGAGACTTTGTAAGGATGTTGG 0: 1
1: 0
2: 0
3: 11
4: 227
1153812546_1153812552 16 Left 1153812546 18:8764727-8764749 CCCACGTAGCCTGGGCACTTTCA 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1153812552 18:8764766-8764788 CTGAGACTTTGTAAGGATGTTGG 0: 1
1: 0
2: 0
3: 11
4: 227
1153812543_1153812552 24 Left 1153812543 18:8764719-8764741 CCCTTTTACCCACGTAGCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1153812552 18:8764766-8764788 CTGAGACTTTGTAAGGATGTTGG 0: 1
1: 0
2: 0
3: 11
4: 227
1153812545_1153812552 23 Left 1153812545 18:8764720-8764742 CCTTTTACCCACGTAGCCTGGGC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1153812552 18:8764766-8764788 CTGAGACTTTGTAAGGATGTTGG 0: 1
1: 0
2: 0
3: 11
4: 227
1153812547_1153812552 15 Left 1153812547 18:8764728-8764750 CCACGTAGCCTGGGCACTTTCAC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1153812552 18:8764766-8764788 CTGAGACTTTGTAAGGATGTTGG 0: 1
1: 0
2: 0
3: 11
4: 227
1153812549_1153812552 7 Left 1153812549 18:8764736-8764758 CCTGGGCACTTTCACATGGTTGC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1153812552 18:8764766-8764788 CTGAGACTTTGTAAGGATGTTGG 0: 1
1: 0
2: 0
3: 11
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153812552 Original CRISPR CTGAGACTTTGTAAGGATGT TGG Intronic
900931807 1:5742580-5742602 CTGAGAGTTTTTAAGGATTTAGG - Intergenic
905017383 1:34786954-34786976 CTGGGACTGTGCAAGGAGGTAGG + Intronic
905329771 1:37186352-37186374 CTGAGACTATGTCAAGATGGTGG - Intergenic
907080842 1:51620347-51620369 CTGGCACTTTGTTAGGAAGTGGG + Intronic
907322717 1:53615582-53615604 CTGAGAAGTTTAAAGGATGTTGG - Intronic
908586130 1:65571612-65571634 CTCAGACCTTGTTATGATGTTGG + Intronic
909331849 1:74422890-74422912 CTGAGACTTTGTATGCATCATGG - Intronic
909572107 1:77126280-77126302 CTGTGACTTTGTAAAGGTGCTGG + Intronic
911344220 1:96676824-96676846 GTGAGACATGGCAAGGATGTTGG - Intergenic
911358701 1:96850716-96850738 GTGAGACTTGGGAAGGATGGCGG + Intergenic
911852288 1:102835114-102835136 CTCAGAGCTTGTCAGGATGTAGG + Intergenic
913211407 1:116585561-116585583 GTGGGTTTTTGTAAGGATGTTGG - Intronic
913296319 1:117324030-117324052 TTGAGACTTCGCAAGGATTTTGG - Intergenic
914752754 1:150546876-150546898 CTGATATTTTGTGAGGATGCAGG + Intergenic
917891362 1:179441437-179441459 CTCAGAGCTTGTCAGGATGTAGG - Intronic
920069019 1:203289359-203289381 CTGGGAATTTTAAAGGATGTGGG - Intergenic
920199300 1:204249709-204249731 CTGAGACTTTGAAGGGAGGAGGG - Intronic
920281164 1:204844801-204844823 CTGAGAGTTTTTAAGGATTCTGG + Intronic
920785207 1:209034503-209034525 TTAAGACTTTGGAAGGCTGTTGG - Intergenic
1063018631 10:2103717-2103739 CAGAGACTTTGTCAGGATCTGGG - Intergenic
1063151074 10:3336827-3336849 AAGAGACTTTGCAAAGATGTCGG + Intergenic
1064051647 10:12065000-12065022 CTGAGATTTTGTATGGAAGGTGG - Intergenic
1070126832 10:73629254-73629276 GTGAGACTTTGTGAGCATGGTGG + Intergenic
1074368218 10:112877336-112877358 CTGAGTCTTTCTCAGGATGAGGG - Intergenic
1074698089 10:116068939-116068961 CTGAGACTTTGTAAGGTATAAGG + Intronic
1075168436 10:120091000-120091022 CTGACAATTTGTAAGCAAGTGGG - Intergenic
1077432338 11:2522054-2522076 CTGAGATGTTGAAATGATGTCGG + Intronic
1077699774 11:4430893-4430915 CTGAGTCTATGTATGGGTGTGGG + Intergenic
1080380887 11:31771369-31771391 GCATGACTTTGTAAGGATGTGGG + Intronic
1083049104 11:59761277-59761299 CTGAGACTTTGGAGATATGTAGG - Intronic
1083379467 11:62253545-62253567 CTCAGAGCTTGTCAGGATGTAGG + Intergenic
1086097555 11:83065819-83065841 CTGTTTCTTTGTAAGGTTGTTGG - Intronic
1087704706 11:101477169-101477191 CTTAGACTGTGTAAAGATCTAGG + Intronic
1087848663 11:103002833-103002855 CTTAGACTTGGAAAGGATTTTGG - Intergenic
1088760948 11:112928243-112928265 CTCAGAGCTTGTCAGGATGTAGG - Intergenic
1090419637 11:126565567-126565589 CTGAGACTTTGTAGAGAAGTGGG + Intronic
1090487799 11:127129619-127129641 CTGGGAATTTGAAAGGAGGTTGG - Intergenic
1090901214 11:131033426-131033448 CTTAGACTTTGGAAGCAGGTTGG - Intergenic
1091176116 11:133559434-133559456 CAGAGCATTTTTAAGGATGTGGG - Intergenic
1092681750 12:10990535-10990557 ATAGGACTTTGTAAGGATTTTGG + Intronic
1095837152 12:46651655-46651677 CTGAGATTTTGTAAACATCTTGG + Intergenic
1096414572 12:51402183-51402205 CTCAGACTTTGAAAAGATATTGG + Intronic
1097554507 12:61120401-61120423 CTGAGACTTTTTAATCATGAAGG + Intergenic
1099723544 12:86395805-86395827 GTGATACATTGTATGGATGTAGG + Intronic
1100346740 12:93738991-93739013 ATGTGACTTTGAAAGGATGCAGG + Intronic
1102291918 12:111707840-111707862 CTGGGAGTTTGTAAAGATGCTGG + Intronic
1102441023 12:112964033-112964055 CTGAGACTGTGTATTGATGCTGG + Intronic
1103836824 12:123828410-123828432 CTAAGAGTTTTTAAGGATTTAGG + Intronic
1104262267 12:127195041-127195063 TTGACTCTTTGTAAGGATTTTGG - Intergenic
1104391977 12:128398482-128398504 CTCAGACCTTGTTATGATGTTGG + Intronic
1104406395 12:128520791-128520813 CTAAGAGTTTTTAAGGATTTAGG + Intronic
1107015073 13:35701815-35701837 CTTAGACTTTGCCAGGGTGTGGG - Intergenic
1109444839 13:62421788-62421810 CTGCAACTTTTTAAAGATGTTGG - Intergenic
1111117149 13:83794091-83794113 ATGAGACTTTGTATTGATGCTGG + Intergenic
1112066639 13:95800039-95800061 GTGAGACTCTGTAAGGTTCTAGG - Intergenic
1112136282 13:96581855-96581877 CTGAGAGTTTGTACTGAAGTGGG + Intronic
1112215359 13:97425176-97425198 ATGAGACTTGGGAAGGATTTGGG + Intergenic
1117134783 14:52724120-52724142 CATAGACTTTGCAAGGATTTGGG + Intronic
1117878669 14:60284043-60284065 CTGAGACTGTGTATGGTTTTAGG + Intronic
1118893256 14:69926093-69926115 CGCAGACTTTGTCAGGATTTTGG - Intronic
1120142994 14:80949307-80949329 CTGAGAGTTTGGAAAGATGCAGG + Intronic
1120692228 14:87605595-87605617 TTAAGACTTTGGAAGGCTGTTGG - Intergenic
1121191375 14:92033756-92033778 CTAAGAGTTTTTAAGGATTTAGG + Intronic
1121656142 14:95597242-95597264 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
1124136076 15:27037451-27037473 CTAAGAGTTTGTAAGGATTCAGG + Intronic
1125246583 15:37647641-37647663 TTAAGACTTTGGAAGGCTGTTGG + Intergenic
1125722116 15:41850188-41850210 CTGAGCCTTTCTTAGGAGGTGGG + Intronic
1127101429 15:55569247-55569269 TTGATACTTTGTATGGATTTTGG + Intronic
1128920816 15:71608419-71608441 CAGAGAATTTGTAATAATGTGGG - Intronic
1130901821 15:88212962-88212984 CTGAGACATTGCAGGGCTGTGGG + Intronic
1132196111 15:99915917-99915939 CTGAGTCTTTGCTAGAATGTGGG + Intergenic
1133366833 16:5216867-5216889 CTGACCCTTTGTCAGTATGTGGG + Intergenic
1134787810 16:16960960-16960982 CTAAGACTTTGTTCGGATGGTGG + Intergenic
1135902028 16:26469359-26469381 CTAAGAGTTTTTAAGGATTTGGG + Intergenic
1136715940 16:32281410-32281432 CTGAGTCTTTTTAAGGGTCTGGG - Intergenic
1136751972 16:32648355-32648377 CTGAGTCTTTTTAAGGGTCTGGG + Intergenic
1136822616 16:33332111-33332133 CTGAGTCTTTTTAAGGGTCTGGG - Intergenic
1136829179 16:33388650-33388672 CTGAGTCTTTTTAAGGGTCTGGG - Intergenic
1136834245 16:33487432-33487454 CTGAGTCTTTTTAAGGGTCTGGG - Intergenic
1138176403 16:54901925-54901947 CTGAGACATAGCAAGGATTTTGG + Intergenic
1141001200 16:80309864-80309886 CTGACACCATGTAAAGATGTGGG - Intergenic
1203010671 16_KI270728v1_random:237088-237110 CTGAGTCTTTTTAAGGGTCTGGG + Intergenic
1203054114 16_KI270728v1_random:908341-908363 CTGAGTCTTTTTAAGGGTCTGGG + Intergenic
1146538473 17:33673809-33673831 GTGAAGCTTTGTAAAGATGTGGG + Intronic
1146821544 17:35986766-35986788 CTGAGACTTGGAAGGGAAGTAGG + Intronic
1150112018 17:62509816-62509838 CTTCTACTTTGTGAGGATGTAGG + Intronic
1151148570 17:72064354-72064376 CAGATACTTTGTAAGTATTTAGG + Intergenic
1153383632 18:4467669-4467691 GTCAGACTTTGTAAGGTTCTAGG - Intergenic
1153812552 18:8764766-8764788 CTGAGACTTTGTAAGGATGTTGG + Intronic
1154468248 18:14670548-14670570 CTGAGACTTTGGGAGGCTGAGGG + Intergenic
1155096682 18:22562734-22562756 CTGAGTCTTGGTTGGGATGTGGG - Intergenic
1155818332 18:30344395-30344417 CTAAGAGTTTTTAAGGATTTAGG - Intergenic
1156984859 18:43338188-43338210 CTAAGAGTTTTTAAGGATTTCGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158137840 18:54225138-54225160 CTGGAACCTTGTAAGGATGTAGG + Intergenic
1159037047 18:63287221-63287243 CTAATACTTTCTAAGGAGGTTGG - Intronic
1160047851 18:75404356-75404378 CTGCCACTTTGAAATGATGTCGG + Intergenic
1161755727 19:6132443-6132465 CTGAGGGTGTGTGAGGATGTGGG + Intronic
1162006225 19:7781519-7781541 CTCAGAGCTTGTCAGGATGTAGG + Intergenic
1162218542 19:9156943-9156965 CTGAGATTTTGCAAGCATGAGGG - Intronic
1167727151 19:51224134-51224156 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
1167826422 19:51977808-51977830 CTCAGAGCTTGTCAGGATGTAGG + Intronic
926281073 2:11446986-11447008 CTGGGTCTTTGTTCGGATGTCGG + Intronic
927431809 2:23032703-23032725 CTAAGTCTTGGTAAGGATGGAGG + Intergenic
928014578 2:27643664-27643686 CTGACATTTTTTAAGCATGTAGG + Intronic
930031924 2:47063685-47063707 CTGTGACTTTATGAGGACGTTGG + Intronic
931906142 2:66845969-66845991 AAGGGACTTTGTAAGGATTTTGG + Intergenic
935120048 2:100176382-100176404 CTGAGACCCTGTAAGTGTGTGGG - Intergenic
936099670 2:109564496-109564518 CTGTGACTTTGTAAAGCTGCGGG - Exonic
936755068 2:115698447-115698469 ATGAGACTTTGTTAGTTTGTTGG + Intronic
936867177 2:117087973-117087995 CTAAGAGTTTTTAAGGATTTAGG - Intergenic
936987777 2:118327986-118328008 CTGAGACTTGCTAAAGATGAAGG - Intergenic
937226724 2:120374617-120374639 CAAAGACTTTGTAGGGCTGTTGG + Intergenic
938262270 2:129904559-129904581 TTGAGAATTTTTAAGGAAGTAGG - Intergenic
938899748 2:135790006-135790028 CTGAGCCTTTCTAAAGATGCTGG - Intronic
940942175 2:159574374-159574396 ATAAGTGTTTGTAAGGATGTGGG + Intronic
942981317 2:182086388-182086410 CTTAAACTTTGTAAGAGTGTGGG + Intronic
943361050 2:186919867-186919889 CTGAGAATATGTAAACATGTGGG + Intergenic
944591343 2:201220589-201220611 CTAAGAGTTTTTAAGGATTTAGG - Exonic
945073771 2:206016529-206016551 CTGAGACTTTGGAGGACTGTTGG + Intronic
946031879 2:216711851-216711873 CTGAGAAATAGGAAGGATGTAGG - Intergenic
947027327 2:225750992-225751014 CTGGGACTTGGAAAGGATGGAGG + Intergenic
947048640 2:226017982-226018004 CTGAGACTTTGGAGGACTGTTGG - Intergenic
947063415 2:226192235-226192257 CTTTGACTTTGGATGGATGTGGG + Intergenic
947837672 2:233187486-233187508 CTGAGACTGGGGTAGGATGTTGG + Intronic
1168905290 20:1398571-1398593 CTCAGAGCTTGTCAGGATGTAGG + Intergenic
1169286534 20:4312276-4312298 CTAAGAGTTTTTAAGGATTTGGG - Intergenic
1170254900 20:14330336-14330358 CTGATACTTTGTATATATGTAGG + Intronic
1171900571 20:30852526-30852548 CTGGGACTTGGTAAGTATTTGGG - Intergenic
1172236117 20:33376138-33376160 CAGAGACTTAGTAGAGATGTTGG - Intronic
1172475579 20:35235113-35235135 CTGAGACTTGGTCTGGCTGTGGG + Intronic
1175239495 20:57536386-57536408 CTAAGAGTTTTTAAGGATTTAGG - Intergenic
1176806270 21:13487101-13487123 CTGAGACTTTGGGAGGCTGAGGG - Intergenic
1177601538 21:23321264-23321286 TTGAGATTATGTATGGATGTAGG + Intergenic
1180321111 22:11322235-11322257 CTGGGACTTGGTAAGTATTTGGG + Intergenic
1180333932 22:11558510-11558532 CTGGGACTTGGTAAGTATTTGGG - Intergenic
1181381625 22:22508941-22508963 CTGAGGCCTTGAAAGGATCTTGG + Exonic
1181989886 22:26829371-26829393 CTGAGACCTGGTAAGGTTTTTGG - Intergenic
1182097326 22:27634804-27634826 CTGAGACTTGGAAAGGAAGCAGG + Intergenic
950738959 3:15034372-15034394 CTGAGGCTTTTGAAGGCTGTAGG + Intronic
955051368 3:55414321-55414343 CTGCTACTCTCTAAGGATGTGGG - Intergenic
956834169 3:73082050-73082072 CTCAGACTTTGTTACGATGTTGG + Intergenic
959142834 3:102506545-102506567 CTAAGACTTTGGAAGACTGTTGG + Intergenic
960278855 3:115758404-115758426 CTGAGATTTTAGAAGGATGTTGG + Intergenic
963613950 3:147510826-147510848 TTGAGAATCTTTAAGGATGTTGG + Intergenic
963967905 3:151393781-151393803 CTGAGTCTTTAAAAGAATGTGGG + Intronic
964187951 3:153968661-153968683 CTGAGACTTTGGGAGACTGTTGG - Intergenic
964203284 3:154142032-154142054 ATGATATTTTGAAAGGATGTAGG + Intronic
965975793 3:174620187-174620209 CTGACACTTTGAAAGGCTCTGGG + Intronic
967197404 3:187040512-187040534 CTGAGACTTAGCAAGGTTATAGG - Intronic
967662246 3:192127229-192127251 CTGAGACTTGGAAAGCATTTTGG + Intergenic
967770820 3:193331686-193331708 CTGAGATCTTGGAAGGATGTTGG - Intronic
968190625 3:196664670-196664692 CTGTGACTTTAGAAGGCTGTGGG + Intronic
968675137 4:1873330-1873352 CTGAGAATTTGAAAGAATGATGG + Intronic
969839567 4:9870850-9870872 CGGAGACTTTGTAAGGATTAGGG + Intronic
970372174 4:15418878-15418900 CTGAGACTGTGTAGGGAATTGGG + Intronic
970410321 4:15800134-15800156 CTAAGAGTTTTTAAGGATTTAGG - Intronic
971128543 4:23780494-23780516 CTTTGAGTTTGTAAGGATGCTGG - Intronic
971540763 4:27813749-27813771 CTAAGAGTTTTTAAGGATTTAGG - Intergenic
971680854 4:29698528-29698550 CCGAGTCTTTTTAAGCATGTGGG + Intergenic
971826922 4:31635588-31635610 CTGATTCTTTGGAAGGATTTGGG + Intergenic
974587238 4:63895627-63895649 CTAAGACTTTGTGAGACTGTTGG - Intergenic
975371994 4:73599815-73599837 TTAAGCCATTGTAAGGATGTTGG - Intronic
975601657 4:76106472-76106494 CTAAGAGTTTTTAAGGATTTAGG + Intronic
975737775 4:77398328-77398350 CTCAGAGCTTGTCAGGATGTAGG - Intronic
979430439 4:120623183-120623205 CAAAGAATTTTTAAGGATGTAGG - Intergenic
979658888 4:123229416-123229438 ATGAAGCTTTTTAAGGATGTGGG + Intronic
982357819 4:154489714-154489736 CTGAGGCCTTGTAATGCTGTTGG + Intronic
983140224 4:164141213-164141235 CTGATACTTTCTAAGGATGGGGG + Intronic
983351803 4:166599541-166599563 CTGAGATTTTGTATAGATTTTGG - Intergenic
983680435 4:170347245-170347267 CTGAGAATTTTTAAGGATTCAGG + Intergenic
985356875 4:189130311-189130333 CTGTGGCTTTATAAGGATGCAGG + Intergenic
986337898 5:6768624-6768646 CTGAGGCTGTGTCAGGGTGTGGG + Intergenic
986489243 5:8272309-8272331 CAGGGGCTTTGAAAGGATGTGGG + Intergenic
987871060 5:23617375-23617397 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
988888095 5:35581483-35581505 CTGAGACTTTGGAGGACTGTTGG - Intergenic
989763938 5:45055947-45055969 ATGAGAATTTTTAAAGATGTTGG - Intergenic
989995050 5:50819386-50819408 CTGAGACCTTGTAGGGAGGAGGG - Intronic
990167637 5:53012216-53012238 CTGAGAATTTGTAAGGTTTGTGG + Intronic
990311448 5:54542721-54542743 GTGAGACTTTCTGAGGAAGTGGG + Intronic
990935797 5:61147856-61147878 CTGAGACATTGTAAAGATCCCGG - Intronic
993540261 5:89140704-89140726 CTGAGACTATTTGAGGTTGTAGG + Intergenic
998259623 5:140619656-140619678 CTAAGAGTTTTTAAGGATTTAGG - Intergenic
1000515904 5:162236234-162236256 TTAAGACTTTGTGAGGCTGTTGG - Intergenic
1001714009 5:173800031-173800053 GTGAGACTGTGAAGGGATGTGGG - Intergenic
1001744546 5:174082022-174082044 CTTAGCATTTGGAAGGATGTGGG + Intronic
1005885614 6:30095534-30095556 CTGATACTCTCTAAGGATATGGG - Intergenic
1006236765 6:32640159-32640181 CAGATACTTTTGAAGGATGTTGG + Intronic
1009525502 6:64739749-64739771 CTGAGAATTTGAAGGAATGTCGG - Intronic
1011464383 6:87640267-87640289 CAGTGACTTTGTAATAATGTGGG + Intronic
1012022255 6:93938414-93938436 CTGAGACTCTGTAATAATTTGGG + Intergenic
1012843604 6:104361797-104361819 CTGACACTTTGTAACTCTGTGGG - Intergenic
1013577385 6:111497791-111497813 CTGAGTTTTTGTATTGATGTTGG + Intergenic
1013755644 6:113458572-113458594 ATGAGACCTGGAAAGGATGTGGG + Intergenic
1014772979 6:125477947-125477969 ATAAATCTTTGTAAGGATGTTGG + Intergenic
1014957824 6:127642898-127642920 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
1015185942 6:130415555-130415577 CTTACATTTTGAAAGGATGTGGG + Intronic
1017495059 6:154976440-154976462 CTGAGAATGTAGAAGGATGTTGG + Intronic
1017649211 6:156565620-156565642 CTGTCACGTTGTATGGATGTGGG - Intergenic
1018335415 6:162782324-162782346 TAGAAACTTAGTAAGGATGTAGG + Intronic
1018932838 6:168253148-168253170 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
1018986224 6:168639079-168639101 CTGAAACATTGCTAGGATGTCGG - Intronic
1021683294 7:23156555-23156577 CTGGGGCTTTGTAAGGATCTTGG + Intronic
1023975917 7:45029913-45029935 GTAAGAATTTGTAAGGATCTAGG + Intronic
1026136255 7:67663914-67663936 CTAAGAGTTTTTAAGGATTTAGG + Intergenic
1029096301 7:98087508-98087530 CTGATACTTAGCAAGGATGCCGG + Intergenic
1029148280 7:98462337-98462359 CTGAGACTGAGTCAGGCTGTGGG + Intergenic
1032041213 7:128563726-128563748 CTTCTACTTTGTGAGGATGTAGG + Intergenic
1035114926 7:156516590-156516612 CTCAGGCTTTGTTAGGATGGAGG - Intergenic
1036638407 8:10566906-10566928 GTGAGGCTTTGTGAGGTTGTGGG - Intergenic
1037511838 8:19591155-19591177 CTGTGGCTTTGTGAGGAGGTGGG - Exonic
1037572567 8:20171108-20171130 GAGAGACTTTGGAAGGCTGTAGG + Exonic
1037741002 8:21609175-21609197 CTGTGACTTTGTCAGGCCGTTGG - Intergenic
1039316759 8:36382138-36382160 CTGAGACTTTGTCTGGCAGTGGG + Intergenic
1041307464 8:56477294-56477316 CTGTGACTTTGTAAAGCTGCGGG - Intergenic
1043471123 8:80563926-80563948 CTGAAACTTTGTTAGGCTCTAGG + Intergenic
1045085750 8:98682468-98682490 CGGTGACTTTGTAAGCATTTCGG - Intronic
1046454780 8:114443776-114443798 TTGATACTTTGTATGGATTTTGG - Intergenic
1047208966 8:122825394-122825416 CTGGTACTTGGTAAGCATGTGGG + Intronic
1049135440 8:140893859-140893881 CTGTCATTTGGTAAGGATGTGGG + Intronic
1049368791 8:142253664-142253686 CTGAGGCCTTGCAAGGAAGTTGG - Intronic
1050986425 9:12088935-12088957 CTGATCCTTTGTATGGATTTGGG + Intergenic
1051484516 9:17593537-17593559 TTGTGTCCTTGTAAGGATGTAGG - Intronic
1052089701 9:24313501-24313523 CTGAGTGTTTATAAGGATGTTGG + Intergenic
1056983375 9:91338339-91338361 ATGAGACTTTTTCAGGATGGAGG - Intronic
1058007948 9:99939734-99939756 CTGAAACATAGTAAGGATCTAGG - Intronic
1061416468 9:130449915-130449937 CTCAAACTTTGTTATGATGTTGG + Intronic
1185922191 X:4105826-4105848 CTGAAACTATGAAAGCATGTTGG + Intergenic
1186318625 X:8399421-8399443 CTGGAACTTTCTAAGGAAGTTGG - Intergenic
1189739481 X:44103345-44103367 GTAAGACTTTGTCAGGAAGTAGG - Intergenic
1190071764 X:47285473-47285495 CTAAGAATTTTTAAGGATTTAGG + Intergenic
1191139784 X:57104783-57104805 CTCAGAGCTTGTCAGGATGTAGG + Intergenic
1193236667 X:79114824-79114846 CTGAGACTGTGTAAAGAAGCAGG + Intergenic
1197151448 X:123224324-123224346 CTTAGAGTTTGGAAGGATTTTGG - Intronic
1197517473 X:127451952-127451974 TAGAGACTTAGTAAGAATGTTGG + Intergenic
1198931605 X:141867488-141867510 CTAAGAGTTTTTAAGGATTTAGG - Intronic
1199312959 X:146343176-146343198 CTGTGACTTAGTTAGGATGGTGG + Intergenic
1200413605 Y:2885829-2885851 CTCAGAGCTTGTCAGGATGTAGG - Intronic
1200562069 Y:4717055-4717077 CTGAAACTATTTAAAGATGTTGG - Intergenic