ID: 1153813088

View in Genome Browser
Species Human (GRCh38)
Location 18:8769183-8769205
Sequence ATGCCCAAGGGCCCATCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153813088 Original CRISPR ATGCCCAAGGGCCCATCTGT AGG Intronic
903070802 1:20726189-20726211 AAGCCCCAGGGCCCATGTGAAGG - Intronic
904606299 1:31699713-31699735 AAGCCCAGGGGCCTGTCTGTGGG - Intronic
906875171 1:49529755-49529777 ATGCTCAAGGGTACATGTGTAGG + Intronic
912411312 1:109482642-109482664 ATGCCCTAGGGATCATCTGTGGG + Intergenic
915449488 1:155994726-155994748 ATGGCACAGGGCCCATTTGTAGG - Intronic
915594824 1:156890661-156890683 AAGACCAAGGGCCCATCAGCTGG + Intergenic
916765122 1:167852838-167852860 GCCCCCAAGGGCACATCTGTAGG - Intronic
917279677 1:173368993-173369015 TTGCCCAAAGCCCCATCAGTGGG + Intergenic
917790042 1:178493602-178493624 ATGCGCAAGGCTCCAGCTGTTGG - Intergenic
921287751 1:213624173-213624195 ATGCCCAAGTGCCTGTCTGGAGG - Intergenic
1069632087 10:69903144-69903166 ATTCCCAAGGGCACCTCTGATGG + Intronic
1070447595 10:76522908-76522930 ATCCCCAAGGCCTCTTCTGTGGG + Intronic
1071507304 10:86240557-86240579 ATGTCCAGGGGCCCACCTCTTGG + Intronic
1071516557 10:86301556-86301578 GTGGCCAAGGGTCCATCTGCTGG - Intronic
1073072843 10:100805757-100805779 ATCCACAGGGGCCCTTCTGTGGG + Intronic
1074226921 10:111493879-111493901 AGGCCCAAGGGCTCTTCAGTTGG + Intergenic
1077514890 11:2995498-2995520 ATGCCCAAAGCCCCCTCAGTAGG + Intergenic
1077844950 11:6013694-6013716 ATGCCCAAGCACACATCTGGGGG + Intergenic
1079873216 11:25826102-25826124 ATGCCCAAGGTCGCATATCTGGG - Intergenic
1080383303 11:31796138-31796160 ATCTCCAAGGGCCCATATGGTGG - Intronic
1084273426 11:68040543-68040565 AGGGCCCAGGGCCCCTCTGTGGG - Intronic
1084778798 11:71395633-71395655 ATACCCAGGAGCCCATCTGTAGG - Intergenic
1088569407 11:111207095-111207117 AAGTCCAAGGGCCCATTTGAAGG - Intergenic
1089048473 11:115525137-115525159 TTTCCCAAGGGCCAATTTGTGGG + Intergenic
1090620805 11:128559460-128559482 TTGACCAAGAGCCCAGCTGTGGG - Intronic
1090650590 11:128802659-128802681 GTGCCCACAGGCCCATCTGATGG - Intronic
1092241336 12:6838060-6838082 GTGACAAAGGGCCCAGCTGTGGG + Intronic
1094828432 12:34288988-34289010 ATTCCCAAGAGCCCTTGTGTGGG + Intergenic
1095887872 12:47207516-47207538 CTGCCCACGTGCCCATCTGCTGG - Intronic
1096214517 12:49791978-49792000 ACGCCCCAGGGCCCACCTTTCGG - Exonic
1096826151 12:54279745-54279767 TGGCCCAAGGGCCGATCAGTCGG + Intronic
1103834391 12:123807545-123807567 CTGACCAAAGGCCCACCTGTGGG - Intronic
1105617705 13:22034854-22034876 ATGCACAATGGCCCATCAGTTGG - Intergenic
1105799956 13:23894422-23894444 CTTCCCAAGCGCCCATCTCTAGG + Intronic
1105849079 13:24318573-24318595 CTTCCCAAGCGCCCATCTCTAGG - Intronic
1108267508 13:48727336-48727358 AGCCCCAAGGGGCCATCTGGAGG - Intergenic
1115095485 14:29630762-29630784 ATTCCCAAGGGCTCCTCCGTGGG - Exonic
1117545483 14:56791532-56791554 ATGCCCGAGGGCCAAGATGTGGG - Intergenic
1121834114 14:97076801-97076823 ATGCCAATGGACTCATCTGTAGG + Intergenic
1122171357 14:99877955-99877977 AGGCCCATGGGCCCATGGGTTGG - Intronic
1122743990 14:103887387-103887409 CTCCTCAAGGTCCCATCTGTTGG - Intergenic
1122944381 14:104999448-104999470 ATGCCCAAGGACCCAGCTGCTGG + Intronic
1123459654 15:20458293-20458315 GTCCCCCAGGGCCCGTCTGTGGG + Intergenic
1123658408 15:22542127-22542149 GTCCCCCAGGGCCCGTCTGTGGG - Intergenic
1123935835 15:25193657-25193679 ATGCCAGGGGGCCCACCTGTGGG - Intergenic
1124265883 15:28234130-28234152 GTCCCCCAGGGCCCGTCTGTGGG + Exonic
1124312273 15:28636619-28636641 GTCCCCCAGGGCCCGTCTGTGGG - Intergenic
1124590617 15:31050159-31050181 ATGACTCAGGGCCCCTCTGTGGG + Intronic
1126004045 15:44239849-44239871 AGGCCCAAGGACCCAGCTTTAGG + Intergenic
1128710167 15:69865835-69865857 ATGCTCAGGGGCCCTTCTCTGGG + Intergenic
1133026909 16:2992504-2992526 ACCCCCAAGAGCCCATCTGTTGG - Intergenic
1133195382 16:4166353-4166375 AACCTCAAGGGCACATCTGTGGG - Intergenic
1133431326 16:5739699-5739721 AGCCCCAAGGGCCTTTCTGTTGG - Intergenic
1133768347 16:8853289-8853311 CTTCCCAAGGGCCCATCTGCTGG - Exonic
1134808182 16:17143556-17143578 ATGACCAAAGGCACATGTGTAGG - Intronic
1134833820 16:17345092-17345114 AGACCCAAGGGGCCAGCTGTTGG + Intronic
1135043682 16:19136951-19136973 TTGCCCAAGGGCACATGTGCAGG - Intronic
1135150536 16:20001553-20001575 ATGACCGAGAGCCCATCTCTGGG + Intergenic
1136704068 16:32171526-32171548 GTCCCCCAGGGCCCATCTGTGGG + Intergenic
1136763842 16:32757880-32757902 GTCCCCCAGGGCCCATCTGTGGG - Intergenic
1136804257 16:33112506-33112528 GTCCCCCAGGGCCCATCTGTGGG + Intergenic
1140450915 16:75070173-75070195 CTGCCCAATGGGCCATCTGCTGG - Intronic
1140932078 16:79636991-79637013 ATGCCCAAGGGACATTCTGGTGG + Intergenic
1203065988 16_KI270728v1_random:1018202-1018224 GTCCCCCAGGGCCCATCTGTGGG - Intergenic
1143006971 17:3843357-3843379 ATGCCTGAGGGCCCAGCTGAGGG - Intronic
1146387839 17:32393393-32393415 ATGCCCATGGTCCCAGCTATGGG + Intergenic
1151934666 17:77254560-77254582 ATGCCCATGGACCCCTCTGGAGG - Intergenic
1152678901 17:81655722-81655744 ATGCCCCAGGGACCACCTCTTGG + Intronic
1153813088 18:8769183-8769205 ATGCCCAAGGGCCCATCTGTAGG + Intronic
1157589629 18:48828719-48828741 ATGCCCGAGGGTGCGTCTGTGGG - Intronic
1158234047 18:55293205-55293227 ATTAGCAAGGGCCCATCTGTAGG + Intronic
1163400840 19:17091625-17091647 AGGCCCATGGTCCCACCTGTGGG + Intronic
1163755716 19:19105254-19105276 CTGCCCAAGGGCATGTCTGTTGG - Intronic
1164596383 19:29533194-29533216 GTGCCCAAGGTCCTATCTGCTGG - Intronic
1164638374 19:29807697-29807719 ATGCACATGGGCCCAACAGTAGG + Intergenic
926995956 2:18736250-18736272 ATGCCCAGGGGGCCGTCTATAGG - Intergenic
927155341 2:20217993-20218015 TTGCCCAAGGGGTCATCGGTGGG - Intronic
928106242 2:28472299-28472321 AAGCCACAGGGCCCATGTGTGGG - Intronic
932858749 2:75266722-75266744 AGGCCCAAGGGCTCTTCAGTTGG + Intergenic
936267777 2:111023521-111023543 ATGAGGAAGGGGCCATCTGTGGG + Intronic
937308956 2:120889939-120889961 ATGCCCAAGGGTGTAACTGTTGG - Intronic
938412129 2:131074012-131074034 ATGCCTGAGGCCCCCTCTGTTGG - Intronic
938604099 2:132874426-132874448 ATGACGTAGGGCCCAGCTGTAGG + Intronic
942791601 2:179767185-179767207 ATGCCTAAGGGACAATCTGGGGG + Intronic
944656626 2:201882130-201882152 ATGCACCACGGCCCCTCTGTTGG - Intronic
944665296 2:201954363-201954385 TTGCCCACGGGCCCGTCTGAGGG - Intergenic
945141071 2:206686670-206686692 ATGCCCATGGGGACATTTGTAGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1172023762 20:31934328-31934350 ATGCACAAGGGCCCCACTGTGGG - Intronic
1174120699 20:48263133-48263155 GTGCTCAAGTGCCCACCTGTGGG - Intergenic
1174961526 20:55162549-55162571 ATTCCCAAGAGCCCACCAGTGGG - Intergenic
1175818857 20:61897749-61897771 ATGGACAATGGCCCATCTCTGGG - Intronic
1179167204 21:38944362-38944384 AAAGCCAGGGGCCCATCTGTTGG - Intergenic
1179190549 21:39118766-39118788 CTGGCCGAGGCCCCATCTGTGGG - Intergenic
1179272793 21:39864678-39864700 TCGTCCCAGGGCCCATCTGTGGG + Intergenic
1179551599 21:42147018-42147040 AGGCCCACGGGCCCGTCTGAGGG - Intergenic
1181033353 22:20158554-20158576 CTGCCCAAGGGCCCACCTGGAGG - Intergenic
1183000783 22:34856944-34856966 ATATGCAAGGGCCCATCTGTAGG - Intergenic
950445720 3:13036604-13036626 ATGCCCTGGGCCTCATCTGTTGG - Intronic
951403256 3:22261753-22261775 AGGCCACAGAGCCCATCTGTTGG + Intronic
952758171 3:36890530-36890552 CTGCCCAAGGGGCCAGCTGTGGG + Intronic
953927993 3:46992103-46992125 ATGGACAAGGGCCCATCCCTTGG + Intronic
956426989 3:69145977-69145999 ATTGCCAAGTGCCCCTCTGTGGG - Intergenic
961049543 3:123734749-123734771 GTCCCCATGGGCCCATCTCTTGG + Intronic
966161966 3:176978090-176978112 CTGCACAAGGGCACATCCGTAGG - Intergenic
968039820 3:195579570-195579592 GTGCCCATGGTCCCCTCTGTGGG + Intronic
976174545 4:82337951-82337973 TTGCCCAAAGCCCCATCTGGGGG - Intergenic
976363998 4:84213052-84213074 ATGCACAAAGACCCTTCTGTGGG + Intergenic
978676714 4:111327181-111327203 GGGCCCAAGGGCTCTTCTGTTGG + Intergenic
978836345 4:113154129-113154151 ATGCAGAAGGGCCCATTTGCTGG - Intronic
978861100 4:113450097-113450119 AAGCCAAAGGGCACCTCTGTTGG - Intergenic
981883731 4:149647814-149647836 ATGGCAAAGGCCACATCTGTAGG - Intergenic
982227878 4:153182339-153182361 TTTCCCAAGGTCCCATTTGTGGG - Intronic
985838100 5:2285134-2285156 ATGCCCAATGCCCCATCAGGTGG + Intergenic
985958615 5:3282785-3282807 GTGCTCATGGGCCTATCTGTAGG - Intergenic
989544665 5:42659434-42659456 ATACTCAAGGGCCCCTCAGTGGG - Intronic
990507162 5:56456104-56456126 CTGCCCAGGGCACCATCTGTGGG + Intergenic
993521802 5:88911963-88911985 ATGCCCATATGCCCATCAGTGGG + Intergenic
995794122 5:115923991-115924013 ATCCTCAAGGATCCATCTGTAGG - Intergenic
998179923 5:139929655-139929677 ATGCCCAAAAGGCTATCTGTAGG + Intronic
999420418 5:151437016-151437038 ACCCCCAAAGCCCCATCTGTAGG - Intergenic
1007227405 6:40324827-40324849 ATGGCCAAGGGCCGATGTGGAGG + Intergenic
1013168951 6:107619065-107619087 ATGCGGAGGGGCCCATGTGTAGG + Intronic
1014831336 6:126106032-126106054 ATGGCCAGTAGCCCATCTGTTGG - Intergenic
1021891377 7:25189000-25189022 ATGCACTAGGCCCCACCTGTGGG + Intergenic
1022949909 7:35328261-35328283 GTGCCCACAGGACCATCTGTTGG + Intergenic
1024227220 7:47335172-47335194 ATGCCCCAGGAGCCATGTGTTGG - Intronic
1024704908 7:51946598-51946620 AAGCCCAAGGCCACATTTGTGGG - Intergenic
1029418675 7:100460238-100460260 ATGCCCAAGAGTACAACTGTTGG + Intronic
1030070146 7:105691110-105691132 ATGCCCAAGGGCTGGTCTGCAGG - Intronic
1036713262 8:11096723-11096745 GAGCCCAAGGACCCAGCTGTTGG - Intronic
1038672385 8:29592634-29592656 ATGGTCAAGGGCCAATCTGAAGG + Intergenic
1041431349 8:57784262-57784284 TCGCCCAAGGGCCCATCAGAAGG + Intergenic
1049213991 8:141399379-141399401 CTGCCCAGAGGCCCATCTGCTGG + Intronic
1052704604 9:31980569-31980591 AGGCCCACAGGCCCATCTGCAGG - Intergenic
1053285674 9:36848220-36848242 ATCCCCAGGGGCCCACCTCTAGG - Intronic
1056226293 9:84498569-84498591 ATGTCCAAAGGCACATCTGGAGG + Intergenic
1059018856 9:110551967-110551989 ATGACCAAGGGCACTTCTTTGGG - Intronic
1060445192 9:123681020-123681042 ATGCCCAATGACCCCTCAGTGGG - Intronic
1062449537 9:136609736-136609758 GTCCCCCAGAGCCCATCTGTGGG + Intergenic
1189773888 X:44452693-44452715 ACGCCAAAGGGGCCATGTGTAGG + Intergenic
1193169038 X:78315221-78315243 AGGCCCAAGGGCTCTTCAGTTGG - Intronic
1193417106 X:81238307-81238329 AGGCCCAAGGGCCCGTAAGTCGG - Intronic
1196233725 X:113255275-113255297 AGGCCCAAGGGCCCTTCAGTTGG + Intergenic
1196419655 X:115508576-115508598 TTGCCCAAGGCCCCATCGGCAGG - Intergenic
1197053943 X:122094437-122094459 AGGCCCAAGGGCTCTTCAGTTGG - Intergenic
1198093363 X:133353778-133353800 ATGACCAAGGGCCCAGGAGTGGG + Intronic
1198996189 X:142577069-142577091 AGGCCCAAGGGCTCTTCAGTTGG + Intergenic