ID: 1153813319

View in Genome Browser
Species Human (GRCh38)
Location 18:8771008-8771030
Sequence ATGAGTGAACAGGAGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 595}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153813311_1153813319 23 Left 1153813311 18:8770962-8770984 CCTCTTATGGCATAATATTTAGA 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG 0: 1
1: 0
2: 4
3: 66
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153813319 Original CRISPR ATGAGTGAACAGGAGGAAGG GGG Intronic
900350646 1:2232952-2232974 ATCAGAGAACCCGAGGAAGGAGG - Intronic
900803852 1:4754840-4754862 ATGAGGGGAGAGCAGGAAGGAGG - Intronic
900983273 1:6058733-6058755 AGGAAGGAACAGGAGGAGGGAGG + Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901427355 1:9190891-9190913 ATCAGGGAACAGGAGGAAAGGGG - Intergenic
901539079 1:9903166-9903188 ATGAGTCATTAGAAGGAAGGAGG + Intronic
902176122 1:14652538-14652560 ATGGGTGAATAGGTGGATGGGGG - Intronic
902275034 1:15333343-15333365 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
902620498 1:17647967-17647989 GTGGGTGAACTGGAGGCAGGCGG + Intronic
902713351 1:18255697-18255719 ATGGGGAAACAGTAGGAAGGGGG - Intronic
902737912 1:18413470-18413492 ATGAGTTAGCCAGAGGAAGGGGG + Intergenic
903360000 1:22771114-22771136 CTGGGTGATCAGGAGTAAGGTGG + Intronic
903909111 1:26709336-26709358 GTGGATGCACAGGAGGAAGGTGG - Intronic
904246783 1:29193730-29193752 ATGACAGAAAAGCAGGAAGGGGG + Intronic
904276511 1:29388248-29388270 GTGGGTGTACAGGAGGGAGGAGG + Intergenic
904855069 1:33491567-33491589 ATGGATGAGCAGGAGGAAGGGGG + Exonic
905343998 1:37299164-37299186 AAGACAGAACAGGAGGGAGGAGG - Intergenic
905415711 1:37802534-37802556 AAGAGGGAAGGGGAGGAAGGAGG + Intergenic
905560968 1:38927061-38927083 AGGAGGGAAAAGGGGGAAGGAGG + Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906204030 1:43977470-43977492 ATGAGAGAACAGAAAGAGGGAGG - Intronic
906510839 1:46409791-46409813 ATCAGTGAAGTGGAGGAAGGGGG - Intronic
906946188 1:50296345-50296367 ATGAGAGAAGAGGAAGAGGGAGG - Intergenic
906996746 1:50803684-50803706 ATGAGTGAAAAGTAGCAAGATGG + Intronic
907236297 1:53051931-53051953 ATGAGTAAACAACAGAAAGGTGG - Intergenic
907557285 1:55355395-55355417 ATGAGTGAACCAGAGGCATGTGG - Intergenic
909414846 1:75394348-75394370 ATGAGAGAATAGGAGAAAAGTGG + Intronic
909515413 1:76501747-76501769 ATGAGTGCACAGTATGAAGCCGG + Intronic
909914756 1:81303133-81303155 GTGAATGAACACGAGGACGGAGG - Intergenic
909979305 1:82079516-82079538 TTGAGTGGACTGGAGGAAAGTGG - Intergenic
910336601 1:86139162-86139184 ATGAGGGAGAAGGAGAAAGGGGG + Intronic
910868094 1:91806138-91806160 ATTAGTGAAAAGGATGGAGGAGG - Intronic
910901878 1:92130113-92130135 ATGAGTGTACAGCAAGAAGGCGG - Intronic
911226649 1:95314411-95314433 ATGAATGAATAAAAGGAAGGAGG + Intergenic
911371204 1:96996879-96996901 ATGAATGAAAAGGAAAAAGGAGG - Intergenic
911377095 1:97064103-97064125 ATAACTGAACAGGAGAAAGGAGG + Intergenic
912352318 1:109025974-109025996 GTCTGTGAACAGGAGGATGGTGG - Intronic
912720989 1:112019803-112019825 GGGAGTTAAAAGGAGGAAGGAGG + Intergenic
913113072 1:115673213-115673235 GTGAGAGAACGGGAGGAAGGAGG - Intronic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
914322520 1:146578870-146578892 AAGAGTGCACAGGTGGAATGTGG - Intergenic
914447618 1:147763251-147763273 ATGAGGATACAGCAGGAAGGAGG + Intronic
914915004 1:151814277-151814299 TTGATGGAAGAGGAGGAAGGAGG + Intronic
915304478 1:154969825-154969847 GGGAGTGAAAAGAAGGAAGGGGG + Intronic
915583281 1:156829143-156829165 AGGAGTGAATAGGAGGTATGAGG + Intronic
917129902 1:171730547-171730569 AGGAGTGGAATGGAGGAAGGGGG + Intronic
917628764 1:176872728-176872750 ATGTTTGAAGAAGAGGAAGGAGG - Intronic
917680793 1:177365074-177365096 ATGAAGGAATAGGTGGAAGGTGG + Intergenic
919554500 1:199033358-199033380 ATCAGTGAACAGGAGGCATTCGG + Intergenic
919738068 1:200965944-200965966 GTGAGTGAACATGGGGCAGGAGG - Intergenic
919928800 1:202208108-202208130 ATGAGTCCTCTGGAGGAAGGAGG + Intronic
920055914 1:203191567-203191589 AAGAGGAAACAGGAGTAAGGGGG - Intergenic
920088348 1:203434348-203434370 ATGAGAGAAGAGGTGGACGGGGG - Intergenic
922069880 1:222181522-222181544 ATGAATTAGCAGCAGGAAGGGGG + Intergenic
922096303 1:222445878-222445900 ATGAGGGGACATGAGGAGGGAGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
922722661 1:227906571-227906593 ATGAGGGAGTAGGAGGAGGGAGG - Intergenic
922912648 1:229230456-229230478 ATGAATTAGCAGGAGGTAGGCGG - Intergenic
922976429 1:229787594-229787616 ATGGGTGAAAAACAGGAAGGGGG - Intergenic
923804966 1:237247710-237247732 TTGAGGTACCAGGAGGAAGGTGG + Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
1063031811 10:2243229-2243251 ATGATTGAAAAGGTAGAAGGAGG + Intergenic
1063047009 10:2402093-2402115 ACAGGTGAACAGGAGCAAGGGGG - Intergenic
1063427088 10:5958954-5958976 AGGGGAGAACAGGAGGAAGAAGG - Intronic
1063438333 10:6052551-6052573 TTGAGGGTACAGGAGGAAGAGGG - Intronic
1064025803 10:11848011-11848033 ATGGGTGAAGACGAGGATGGAGG - Intronic
1065633016 10:27700750-27700772 AGTAGTGAACAAGAGGAAGGTGG + Intronic
1065761151 10:28984514-28984536 ATGAGTCACCATGAGGAAAGTGG + Intergenic
1066228373 10:33407221-33407243 TTGAGAGAACAGGAGGGAGCTGG + Intergenic
1066780840 10:38943067-38943089 ATGAGAGAAAAGAAGGAGGGTGG + Intergenic
1068134330 10:52936849-52936871 ATGAGGGAAAAGCAGGAAAGGGG + Intergenic
1068340204 10:55691906-55691928 AAGAGAGAACAGGTGGAAGAAGG - Intergenic
1069718503 10:70535522-70535544 AGGAAAGAAGAGGAGGAAGGAGG - Intronic
1070706837 10:78645922-78645944 CTTAGGGAACAGGGGGAAGGAGG - Intergenic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1071440560 10:85688693-85688715 ATGAGTGGCCAGGTGGATGGTGG + Intronic
1071467867 10:85957560-85957582 ATCAGAGAGCAGTAGGAAGGAGG + Intronic
1071745874 10:88418974-88418996 AAGAGAGAACAGGAGAAAGTAGG - Intronic
1072740704 10:97907419-97907441 ATGAGTGCAGAGGAAGGAGGAGG + Intronic
1072779252 10:98234319-98234341 ACGAGTGCACAGGTGGAATGGGG - Intronic
1073574217 10:104608312-104608334 TTGAGTGAAAAGGAAGAAAGGGG - Intergenic
1073703245 10:105954157-105954179 AGGAAAGAACAGGAGGAAGGAGG + Intergenic
1074104055 10:110375866-110375888 ATGAGTGAAGGGGTGCAAGGAGG - Intergenic
1074527925 10:114277854-114277876 ATGAGGGGGCAGGAGGAGGGTGG + Intronic
1074733315 10:116400827-116400849 ATGAGTTAGCATGATGAAGGAGG + Intergenic
1074872285 10:117586733-117586755 ATGGGTGAATAGGTGGATGGGGG - Intergenic
1074921528 10:118019353-118019375 AGGAGGGAAGAGGAGGAAGAGGG + Intronic
1074955873 10:118388636-118388658 GTGAGGACACAGGAGGAAGGTGG + Intergenic
1075328349 10:121553242-121553264 AGGAGAGAAGAAGAGGAAGGAGG + Intronic
1075584620 10:123648649-123648671 ATGAGTGACAAAGGGGAAGGAGG + Intergenic
1076513254 10:131027151-131027173 ATGCGTGAACAAGAGGAAAAAGG - Intergenic
1076645097 10:131948093-131948115 ATGAGTGAAAAGGAAGGAAGTGG + Intronic
1076736895 10:132462998-132463020 ATGACTGAAGAGGGAGAAGGAGG - Intergenic
1077536478 11:3127153-3127175 ATTTCTGGACAGGAGGAAGGAGG + Intronic
1077606264 11:3614909-3614931 ATGAGTGGAGAGGAGGAGAGAGG - Intergenic
1078390510 11:10931987-10932009 GTGACAGAACAGGAGGAAAGGGG + Intergenic
1079410279 11:20181094-20181116 AAGAGGGAGGAGGAGGAAGGAGG - Intergenic
1080112453 11:28583435-28583457 ATTAGTGAGCGGGAGGTAGGAGG + Intergenic
1080824283 11:35834869-35834891 AGCAGTGAGCAGGGGGAAGGTGG - Intergenic
1081465831 11:43316022-43316044 TTGAGAGAACAGGAGGAATCAGG - Intronic
1081683019 11:45022051-45022073 ATGAGCAAACAGTGGGAAGGAGG + Intergenic
1081981757 11:47270819-47270841 ATGGGAGAACTGGAGCAAGGAGG - Intronic
1082858424 11:57829962-57829984 ATGAGTGCAGAGGAAGGAGGTGG + Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083159115 11:60843775-60843797 GTGAGGGACCATGAGGAAGGAGG + Intronic
1083433309 11:62626204-62626226 ATAACAGAACAGAAGGAAGGAGG + Intronic
1083625663 11:64070842-64070864 AAGAGGGGAGAGGAGGAAGGAGG + Intronic
1083860565 11:65417995-65418017 GTGAGTGCTCAGGAGGACGGGGG + Intergenic
1084546005 11:69815362-69815384 GTGAGTGGATGGGAGGAAGGAGG + Intronic
1086504707 11:87493287-87493309 AGGAGTGGACAGGAGGAGTGGGG + Intergenic
1087327517 11:96741856-96741878 ATGAGGATACAGGAGAAAGGAGG + Intergenic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1088841008 11:113627489-113627511 AGGAAGGAAAAGGAGGAAGGAGG + Intergenic
1089094009 11:115903084-115903106 ATGAGTGAAGAGGTGAAAGCAGG + Intergenic
1089304547 11:117518208-117518230 ATTTCTGGACAGGAGGAAGGAGG + Intronic
1089325417 11:117653438-117653460 ATGAATGAGCTGGGGGAAGGGGG - Intronic
1090467245 11:126945397-126945419 AGGAGTGAACTGCTGGAAGGAGG - Intronic
1090717771 11:129445256-129445278 ATGACTGACGAGGAAGAAGGTGG - Intronic
1090748439 11:129725792-129725814 ATGGGTGGGCAGGAGGATGGTGG - Intergenic
1091324697 11:134677481-134677503 AGGAGGGAACAGGAGGTTGGCGG - Intergenic
1091754685 12:3043741-3043763 CAGAGTGAACAGGAGAGAGGAGG + Intergenic
1091807514 12:3366600-3366622 ATGAGGGGAGGGGAGGAAGGGGG - Intergenic
1092614501 12:10204354-10204376 ATGAGAGAAAAGGTGGAAAGAGG - Intergenic
1092889382 12:12954548-12954570 ATGACTAACCAGCAGGAAGGGGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093508369 12:19896592-19896614 AAGAAAGAAGAGGAGGAAGGAGG - Intergenic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094475385 12:30836795-30836817 ATGAGTGAACGGTAGGAAGGTGG - Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1095518888 12:43038329-43038351 AAGAAAGAACATGAGGAAGGAGG - Intergenic
1095696649 12:45151492-45151514 ATGAGAGAACAGAACTAAGGGGG - Intergenic
1095812206 12:46383341-46383363 AAGAGAGAAAAGGAGGAGGGAGG + Intergenic
1097625429 12:61994370-61994392 AAAAGGCAACAGGAGGAAGGAGG - Intronic
1098594334 12:72254575-72254597 CTGAGTGAAGATGAGGAAGAAGG - Intronic
1099064938 12:77964004-77964026 AGGAGGGAAGAGGAGGGAGGAGG - Intronic
1099135172 12:78888794-78888816 GACAGTGAGCAGGAGGAAGGAGG - Intronic
1099843220 12:87993684-87993706 GTGTGTGAAGAGTAGGAAGGAGG - Intronic
1100647690 12:96548534-96548556 ATGAATGTACAGGAGGACTGTGG + Intronic
1100783664 12:98056195-98056217 ATGAGCACACAGGATGAAGGTGG + Intergenic
1101331438 12:103761029-103761051 ATGAGTGATCAGAAGGAAAGTGG - Intronic
1102230370 12:111257646-111257668 AAGAGGGAGGAGGAGGAAGGAGG - Intronic
1102751139 12:115295784-115295806 ATGAGAGACCAAGAGGAAGAGGG - Intergenic
1103168501 12:118791875-118791897 ATTAGTGAAAAGGAGGATGGTGG - Intergenic
1103368232 12:120398528-120398550 ATGAATGAAGAGCAGGGAGGTGG - Intergenic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104124963 12:125837678-125837700 GTGAGGGAAAAGGAGGGAGGAGG + Intergenic
1104734205 12:131126898-131126920 ATGAGTGAAATGGAGTGAGGGGG + Intronic
1105046407 12:133007537-133007559 GTGAGTGAGAAAGAGGAAGGTGG + Intronic
1106451769 13:29888821-29888843 GTGAGTTATCAGAAGGAAGGAGG + Intergenic
1106655650 13:31743614-31743636 AGGCTTGAACAGGAGCAAGGGGG - Intronic
1107000132 13:35534462-35534484 TTGAGAGCACTGGAGGAAGGTGG - Intronic
1107072583 13:36286914-36286936 AGGAGTGGAGAGGAGAAAGGAGG - Intronic
1107421005 13:40246385-40246407 AAGAGGAATCAGGAGGAAGGAGG - Intergenic
1107430051 13:40332415-40332437 ATGACTGAACCTGAGGAAGGGGG + Intergenic
1107788457 13:43977638-43977660 ATGGGAGAGAAGGAGGAAGGAGG - Intergenic
1107999430 13:45892727-45892749 AAGAAGCAACAGGAGGAAGGAGG + Intergenic
1108711255 13:53034678-53034700 ATGAGAGCACAGGAAGAAAGTGG + Intronic
1108730727 13:53232742-53232764 ATGATTAAAAATGAGGAAGGAGG + Intergenic
1108963065 13:56261390-56261412 ATGAGTGAGAAGGTGGATGGAGG - Intergenic
1109159962 13:58958921-58958943 ATTAGTGAACAGAATGAAGGTGG - Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1110580220 13:77113163-77113185 AGGAGTGGAGATGAGGAAGGAGG - Intronic
1110897959 13:80780461-80780483 ATGAGAGAGGAGGAGGAAAGTGG + Intergenic
1112104316 13:96223997-96224019 AGGAGAGAAGAGGAGGAAAGGGG - Intronic
1113154778 13:107307316-107307338 ATGAGAGAACAGAGGGAAAGAGG + Intronic
1113558363 13:111256617-111256639 AGCAGGGAAGAGGAGGAAGGAGG - Intronic
1114470172 14:22955542-22955564 ATGAGTGAACTGGGGGAAAAGGG + Intronic
1114552113 14:23538714-23538736 AGGAGGCAAGAGGAGGAAGGAGG + Intronic
1115786192 14:36828742-36828764 ATGAGGGAGCAGGAAGAACGAGG - Intronic
1116182428 14:41552012-41552034 GGGAGTGATCATGAGGAAGGAGG + Intergenic
1117896360 14:60491506-60491528 ATTAATGAAAAGGATGAAGGAGG - Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118480284 14:66158086-66158108 AAGAGAGAACAGGAAAAAGGAGG - Intergenic
1118916493 14:70111867-70111889 ATGAGGGGAGAGGAGGAAAGGGG + Intronic
1119971824 14:78979495-78979517 ATGAGTGAACAGTAGTTGGGTGG - Intronic
1120180371 14:81336875-81336897 ATGAGTGATCAGCAGGAGGAGGG + Intronic
1120811135 14:88804432-88804454 AAGAGGGAACAAGAGGAAGCTGG - Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1121481169 14:94276005-94276027 ATGGGGGAAAAGGAGAAAGGAGG - Intronic
1121504755 14:94468354-94468376 ATGAGTGAACATGTGGATGAAGG + Intronic
1122771689 14:104100554-104100576 AGGAGGGAACAGCAGGAAGAAGG - Intronic
1123200263 14:106656838-106656860 ATAATTGAACAGGCTGAAGGCGG + Intergenic
1124139113 15:27061983-27062005 GTCAGTGGACAGAAGGAAGGAGG - Intronic
1125646784 15:41279234-41279256 TTTACTGCACAGGAGGAAGGGGG + Intronic
1127762106 15:62149623-62149645 ATGTGTGAGCTGGAGGAATGAGG + Intergenic
1127927353 15:63559913-63559935 ATGGGAAAACAGCAGGAAGGCGG + Exonic
1128154285 15:65383073-65383095 CTGAGTGAAGAGGAGGCAGGAGG + Exonic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1128758987 15:70202475-70202497 ATCAGTGAACGGGTGGATGGAGG - Intergenic
1128793684 15:70450134-70450156 ATGAGTGGATAGAAGGATGGAGG + Intergenic
1128846425 15:70901106-70901128 ACTGGGGAACAGGAGGAAGGAGG - Intronic
1129225020 15:74164337-74164359 ATGTGTGAACATCATGAAGGAGG + Intergenic
1129685144 15:77681743-77681765 ATGAGGGGACAGGTGGAGGGAGG + Intronic
1130763847 15:86850388-86850410 ATGTGTGAAAAACAGGAAGGGGG - Intronic
1130832533 15:87616306-87616328 ATGGGTGGATTGGAGGAAGGAGG - Intergenic
1131119426 15:89813679-89813701 AGGGGTGACCAGGAGGAAGTGGG - Intronic
1132097172 15:98995825-98995847 GTAGGTGAAGAGGAGGAAGGTGG - Intronic
1132733441 16:1374426-1374448 AGGTGAGGACAGGAGGAAGGGGG - Intronic
1133142748 16:3759978-3760000 GTGAGTGAACATGAGCCAGGTGG - Intronic
1133668995 16:7999148-7999170 ATGCAAGAACAGGAGGAGGGGGG - Intergenic
1133887646 16:9845576-9845598 ATGAGTTACAAGGAGGATGGAGG - Intronic
1133971598 16:10572085-10572107 ATGAGGGAGCAGGAGAAAGAGGG + Intronic
1137582699 16:49643504-49643526 CTGACTGAACAGGACTAAGGGGG - Intronic
1138153969 16:54685876-54685898 AGGAGGGAGCAGGAGGGAGGAGG - Intergenic
1138248952 16:55487862-55487884 AAGAATGAAGAGGAGGAGGGAGG - Intronic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138372736 16:56540220-56540242 GTGAATGACCATGAGGAAGGAGG - Intergenic
1138573156 16:57888985-57889007 AGGCGTGAACACCAGGAAGGGGG - Intronic
1139301115 16:65946184-65946206 GTGAGGGATGAGGAGGAAGGAGG - Intergenic
1139425046 16:66874017-66874039 AGGAGGGAGGAGGAGGAAGGAGG - Intergenic
1139545884 16:67649361-67649383 CTGAGGGAACAAGAGAAAGGAGG - Intronic
1139946366 16:70645075-70645097 AAGAGGGAAGAGTAGGAAGGAGG + Intronic
1140011103 16:71132305-71132327 AAGAGTGCACAGGTGGAATGTGG + Intronic
1140599235 16:76455486-76455508 AACAGTGAAAGGGAGGAAGGTGG - Intronic
1140966630 16:79972581-79972603 ATCAGAGAACAGGAGGGAGCAGG + Intergenic
1141472218 16:84246831-84246853 TGGAATAAACAGGAGGAAGGTGG + Intergenic
1141646230 16:85369515-85369537 ATGTGAGAACAGGAGCAAGTGGG - Intergenic
1141813599 16:86393581-86393603 AGAAGTGAAAAGGAGGATGGGGG + Intergenic
1142251467 16:88993831-88993853 AGGAGGGAGGAGGAGGAAGGAGG - Intergenic
1142872245 17:2828525-2828547 AGGTGTGAAGATGAGGAAGGAGG + Intronic
1142992195 17:3739011-3739033 ATGAGGGAAGGGGAGGAAGGGGG - Intronic
1143208837 17:5167902-5167924 TAGAGGGAACAGGAGGAAAGGGG - Intronic
1144618161 17:16796013-16796035 TGGAGGGAACAGGAGGAAAGGGG - Intronic
1144894543 17:18519682-18519704 TGGAGGGAACAGGAGGAAAGGGG + Intergenic
1145137683 17:20424562-20424584 TAGAGGGAACAGGAGGAAAGGGG - Intergenic
1145279731 17:21458382-21458404 ATGAATGAAGGGGAGGGAGGCGG + Intergenic
1146006235 17:29162473-29162495 ATGAGTGAAGCGGAGGCAAGAGG - Intronic
1146446186 17:32934659-32934681 ATGAGTGTGCAGGGGGAAGCAGG - Intronic
1147886511 17:43687936-43687958 ATGAGGGAAGAGCAGGCAGGGGG + Intergenic
1148394609 17:47298195-47298217 ATGAGTCAACAGGGGCATGGGGG + Intronic
1148583559 17:48760641-48760663 ATGAGTGAACAGACAGGAGGTGG + Intergenic
1148634147 17:49134093-49134115 GTGACTGAAAAGGAGGAAGCTGG + Intronic
1148690907 17:49526364-49526386 CTGAGTGGGCAGGAGGGAGGTGG - Intergenic
1149338500 17:55662627-55662649 ATGGGTGAAGGGAAGGAAGGAGG - Intergenic
1149537857 17:57446281-57446303 TTCAGGGAACAGAAGGAAGGAGG + Intronic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1149737684 17:59011489-59011511 ATGAGTGCAGAGGTGGAAGGTGG + Intronic
1149871453 17:60185659-60185681 TAGAGGGAACAGGAGGAAAGGGG + Intronic
1151339564 17:73461659-73461681 ATGGGTGAATAGGTGGATGGAGG + Intronic
1152000077 17:77639892-77639914 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1152000085 17:77639915-77639937 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1152132978 17:78488404-78488426 AGGAGTGACCTGGAGGAAGCAGG - Intronic
1152477786 17:80529347-80529369 ATGGCTGCAGAGGAGGAAGGCGG - Intergenic
1152598376 17:81249260-81249282 AGGAGGGAGGAGGAGGAAGGAGG + Intronic
1152598381 17:81249277-81249299 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598386 17:81249294-81249316 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598391 17:81249311-81249333 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152598396 17:81249328-81249350 AGGAGGGAAGAGGAGGAAGGAGG + Intronic
1152648897 17:81482908-81482930 AGCGGTGAACAGGAGGAAAGAGG + Intergenic
1152728226 17:81958042-81958064 TTGGGTGGACTGGAGGAAGGCGG + Intronic
1152777837 17:82213374-82213396 ATTAGGGAACTGGGGGAAGGAGG + Intergenic
1153683164 18:7520252-7520274 ATGACTGAAAATGAGGAAAGAGG - Intergenic
1153812713 18:8765894-8765916 CTGAGTGGACAGAAGGAAAGAGG - Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1154307984 18:13244227-13244249 GTGAGTGGACAGGAGGTAGATGG - Intronic
1154492388 18:14932037-14932059 GTGAGTGTGCAGGAGGGAGGTGG - Intergenic
1155049772 18:22136513-22136535 ATGAGAAAACAGCTGGAAGGAGG + Intergenic
1155066576 18:22273873-22273895 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1155066592 18:22273922-22273944 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1155066601 18:22273948-22273970 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1155066615 18:22273987-22274009 AGGAGGGAAGAGGAGGAGGGAGG - Intergenic
1155694202 18:28665149-28665171 AGGAGGGAACTGGTGGAAGGTGG - Intergenic
1155694669 18:28671115-28671137 AGGAGGGAACACAAGGAAGGAGG + Intergenic
1155932048 18:31718678-31718700 AGGAGTGGAGAGGAGGCAGGGGG - Intergenic
1156111419 18:33731847-33731869 ATGTGTGAGGAGGAGGAAGGGGG - Intronic
1156338482 18:36189489-36189511 ATGAGGGGAGAGGAGGAACGAGG - Intronic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1159573727 18:70149820-70149842 ATAAGTGAACAGGAAGTGGGTGG - Intronic
1159814036 18:73051794-73051816 CTGAGTGATTAGGAGCAAGGTGG - Intergenic
1160113050 18:76052105-76052127 GTGAGTGAGCAGGAGGGAAGGGG - Intergenic
1160237669 18:77098932-77098954 AGGAGTGAGAAGGAGGAGGGAGG - Intronic
1161085551 19:2333318-2333340 TTGCGGGAGCAGGAGGAAGGTGG + Intronic
1161155828 19:2731568-2731590 ATGAGTGACGAGGTGGGAGGTGG + Intronic
1162339209 19:10081745-10081767 AGGAGGGAGGAGGAGGAAGGAGG + Intergenic
1162462150 19:10819650-10819672 GTGAGGGAAAAGGAGGATGGAGG + Intronic
1163171642 19:15535590-15535612 ATGAGTGGATAGGTGGAAGGTGG - Intronic
1164478743 19:28595226-28595248 ATGAGTGGATAGAAGGAAAGAGG + Intergenic
1164725769 19:30464771-30464793 ATGAGTGCCCAGGAGGGAGAGGG + Intronic
1165155124 19:33782225-33782247 ATGAGTTCACAGCAGGAAGAGGG - Intergenic
1165204273 19:34170749-34170771 ATGAATGAACAGCAGGATGAAGG - Intergenic
1165470478 19:36001163-36001185 AAAAGTGAGCAAGAGGAAGGGGG - Intergenic
1165791716 19:38496608-38496630 ATGAGTGAGCTGGTGGAAAGTGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1167094504 19:47367164-47367186 CTGAGTGATCAGGAGGGGGGTGG - Intronic
1167145071 19:47676495-47676517 AAGAGGGAGAAGGAGGAAGGAGG - Intronic
1167191248 19:47991609-47991631 AGGAGGGAAGAGGAGGAAGAGGG - Intronic
1167577792 19:50326049-50326071 AGGAGTGATTACGAGGAAGGGGG + Intronic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1167651453 19:50732114-50732136 ATGAGGGCACAGCAAGAAGGCGG - Intergenic
1168299021 19:55392882-55392904 ATTAGGGAAAAGGAGCAAGGGGG - Intronic
1168318975 19:55497781-55497803 ATGAGTGGAAAGGAAGATGGGGG + Intronic
925294801 2:2769374-2769396 CTGAGGGACTAGGAGGAAGGAGG - Intergenic
925903216 2:8523328-8523350 ATGAGTGAAGAGGAGTGAGCTGG - Intergenic
925957012 2:8976616-8976638 ATCCCTGAACAGGAAGAAGGGGG + Intronic
925961442 2:9020977-9020999 ATGAAAGAAAAGGAGGAAGAAGG - Intergenic
926118700 2:10229305-10229327 AAGCGTGAACAGGGGGAGGGTGG + Intergenic
926616353 2:15000578-15000600 CTGAGTCCACAGGAGGTAGGCGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926804563 2:16695092-16695114 ATAAGTGAAAGGGTGGAAGGGGG - Intergenic
926936798 2:18093961-18093983 ATGAGTGACCAGGGGCCAGGAGG - Intronic
928260985 2:29766488-29766510 ATGAATGAACAGGAGGTGGTGGG - Intronic
928269297 2:29841990-29842012 AGGAGTGAAGAGGAGGATGGAGG - Intronic
928409392 2:31042827-31042849 GGGAGAGCACAGGAGGAAGGAGG - Intronic
928603484 2:32923535-32923557 ATAAGTGAATAGGAGAAATGGGG - Intergenic
929439480 2:41953953-41953975 ATGAGTGCTAAAGAGGAAGGGGG - Intronic
929440307 2:41960976-41960998 GGGAGTGAACCAGAGGAAGGAGG - Intergenic
929607115 2:43242019-43242041 CTAAGTGAAAAGGAGGAAGAAGG - Intronic
930642008 2:53862899-53862921 AGGAGGGAAAAGGAGAAAGGGGG - Intergenic
930654359 2:53993328-53993350 AGGAGTGAAATGAAGGAAGGAGG + Intronic
930751746 2:54941273-54941295 ATGAGTGAACAGCAGAAGAGAGG - Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931261860 2:60626984-60627006 ATGAATGAAGAGGGGGAAGAAGG + Intergenic
931493182 2:62772155-62772177 AAGAGAGAAAGGGAGGAAGGGGG + Intronic
931803975 2:65786838-65786860 ATGAGAGACATGGAGGAAGGGGG - Intergenic
932406392 2:71515585-71515607 AGGAAAGAGCAGGAGGAAGGGGG - Intronic
934932104 2:98435065-98435087 ATCAGTGAACAGGACAAAGGAGG - Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935383568 2:102478536-102478558 ATGAGGGAAAAGGAGAAACGAGG - Intronic
936681038 2:114771612-114771634 ATAGGTGAATAGAAGGAAGGAGG + Intronic
937288858 2:120769962-120769984 ATGAGGGGACAGGAGGCAGCAGG - Intronic
937419339 2:121741249-121741271 ATGAGAGACCAGGAGGGAGAGGG + Intronic
939117676 2:138079348-138079370 AGGAAGGAAAAGGAGGAAGGAGG - Intergenic
939590650 2:144059907-144059929 AGGGGTGAGTAGGAGGAAGGTGG - Intronic
940293547 2:152099512-152099534 ATGAGTGAAGTCGCGGAAGGTGG - Intergenic
940448052 2:153801495-153801517 ATGAATGAACAGCTGGTAGGTGG + Intergenic
940984873 2:160043060-160043082 GTGAATGAAGAAGAGGAAGGAGG + Intronic
942035063 2:172002744-172002766 ATGGGTGAAAGGGAGGAAGAGGG - Intronic
944444882 2:199779513-199779535 ATGAGTGCACATGTGGAAGGTGG - Intronic
945047035 2:205790725-205790747 ATGAATCAACAAGAGGAAGGTGG - Intronic
945198096 2:207256119-207256141 AGGAGAGAAAAGGAGGGAGGAGG + Intergenic
945975757 2:216269383-216269405 ATGACAGAAGAGGAGGCAGGTGG + Intronic
946181312 2:217950783-217950805 AAGAGTGCAGAGGAGGAAGAGGG - Intronic
946256310 2:218444777-218444799 ATGAGTAAACAACAGGGAGGCGG + Intronic
946325136 2:218981150-218981172 GTGTGGGGACAGGAGGAAGGGGG + Exonic
946862486 2:224013697-224013719 AGGAGTGACCAGGCGGTAGGTGG + Intronic
947008151 2:225536233-225536255 TTGGGAGAACAGGAGGAAGAAGG - Intronic
947295236 2:228623662-228623684 ATGAGGGAACAGGAAGGTGGTGG + Intergenic
947450911 2:230207963-230207985 ATGAGAGTACAAGAGGAAGCTGG - Intronic
947507939 2:230724292-230724314 TTGTGTGAACAGGAGGCATGTGG + Intronic
947760956 2:232603460-232603482 AGGAGGAAAGAGGAGGAAGGAGG + Intergenic
948091849 2:235301936-235301958 AGGAGGGAGCAGGAGGGAGGAGG - Intergenic
1169130865 20:3165858-3165880 ATGAGTGCACTGGGGGAGGGCGG + Exonic
1169411959 20:5378659-5378681 AAGAGGGAACTGGAGGTAGGGGG + Intergenic
1169433068 20:5556860-5556882 ATTAGTGCCCAGGAGGATGGAGG + Intronic
1169674694 20:8140544-8140566 ATGACTGAACAGGGGTAAGCAGG - Intronic
1169904948 20:10593010-10593032 ATAAGAGAACAGGAAGAAAGAGG - Intronic
1170214154 20:13874142-13874164 AAGAGAGAACTGGAGGAATGTGG + Intronic
1170343613 20:15357774-15357796 ATGAATGAACAGTAAGAATGTGG - Intronic
1170578997 20:17683936-17683958 AACAGTGAACAGGATAAAGGAGG - Intergenic
1171749012 20:29029099-29029121 AGGTGTGAACAGGAGGCAGGAGG + Intergenic
1171905053 20:30893704-30893726 AGGAGAGAACAGAGGGAAGGAGG - Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1172785467 20:37465469-37465491 AGGAGAGAAGAGGAGGAAGGAGG - Intergenic
1172993541 20:39053237-39053259 AGGTGTGAACAGGAAGAAAGAGG + Intergenic
1173348050 20:42219083-42219105 ATTAGTGTACACTAGGAAGGCGG + Intronic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1173623681 20:44455812-44455834 ATGAGTGAAGAGAAGAAGGGAGG + Intronic
1174547174 20:51334303-51334325 AGGAGGGAAGAGAAGGAAGGAGG + Intergenic
1174684981 20:52446037-52446059 ATGAGGGAAAAGAAGGCAGGAGG + Intergenic
1175142537 20:56871824-56871846 ATGGGTGATCAAAAGGAAGGCGG - Intergenic
1175565420 20:59971951-59971973 ATTATTGAACAGCTGGAAGGAGG - Exonic
1175652345 20:60736254-60736276 ATGGAGGAACAGGAGGCAGGAGG - Intergenic
1175831452 20:61967188-61967210 ATGAGTGCTCAGGACGGAGGCGG + Intronic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1176661927 21:9644908-9644930 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1177376644 21:20279202-20279224 ATGACTGAACTTGAGGAAAGGGG - Intergenic
1177816867 21:25987267-25987289 ATGAGTGAGCAGGCTGAAGGAGG - Intronic
1178329641 21:31676648-31676670 AAGAGTAGACAGGATGAAGGAGG - Intronic
1178940703 21:36902648-36902670 AAGAGAGAAAAGAAGGAAGGAGG + Intronic
1179267283 21:39814910-39814932 ATGAGTACACAGCAAGAAGGTGG + Intergenic
1179347093 21:40568835-40568857 ATGAGCCAACTGGAAGAAGGGGG + Intronic
1179788815 21:43743892-43743914 AGGCGTGCAGAGGAGGAAGGAGG - Intronic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1179981415 21:44897802-44897824 AGGACTGAGCTGGAGGAAGGAGG - Intronic
1180070850 21:45435247-45435269 AGGAGAGAAGAGGAAGAAGGGGG + Intronic
1180070863 21:45435281-45435303 AGGAAGGAAGAGGAGGAAGGTGG + Intronic
1180173077 21:46070782-46070804 ATGAGTGGCCAAGAGAAAGGCGG - Intergenic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1180756946 22:18168907-18168929 ATGAGGGAAGTGGAGGTAGGAGG - Intronic
1181074825 22:20368535-20368557 ATGAGGGAAGTGGAGGTAGGAGG + Intronic
1181406727 22:22690224-22690246 GTGAGTGGACAGGGGGAAGCTGG + Intergenic
1182059937 22:27389559-27389581 AAGAGTGCACAGAAGAAAGGAGG + Intergenic
1182072614 22:27474375-27474397 ATGAACGAACAGCAGGAGGGAGG + Intergenic
1182452212 22:30428395-30428417 ATGAGGGAACAGAAGGCAGAAGG - Intronic
1182546982 22:31082139-31082161 ATGAATCAACAGGAGGTGGGGGG + Intronic
1182923243 22:34099338-34099360 ATGGATGAACATGAGGATGGTGG - Intergenic
1183099956 22:35577941-35577963 ATGGATGAATGGGAGGAAGGTGG + Intergenic
1184067775 22:42130006-42130028 AGGAGTGAGCAGGTGGAAGGAGG + Intronic
1184070510 22:42143678-42143700 AGGAGTGAGCAGGTGGAAGGAGG + Intergenic
1184072250 22:42153313-42153335 AGGAGTGAGCAGGTGGAAGGAGG + Intergenic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184250484 22:43257503-43257525 AATAGGGACCAGGAGGAAGGAGG + Intronic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
949520996 3:4853912-4853934 ATGAGTGAAAAGGAAGGGGGAGG - Intronic
949775836 3:7631465-7631487 ATGAGTGAATGGGATAAAGGAGG - Intronic
950159611 3:10750269-10750291 GTGAGGGAACATGAGGATGGTGG - Intergenic
950915263 3:16638000-16638022 ATGGGTGGACAGGTTGAAGGCGG + Intronic
951755488 3:26086897-26086919 AGGAGAGAAAAGGATGAAGGAGG + Intergenic
952388453 3:32860070-32860092 AGGAGAGAACAGGAGGAGAGGGG - Intronic
954215074 3:49120244-49120266 AAGTGTGTAAAGGAGGAAGGAGG + Intronic
954872839 3:53780787-53780809 AGGAGTGACCAGGAGGTGGGGGG + Intronic
954876481 3:53806009-53806031 AGGAGGGAACATGAGGGAGGAGG - Intronic
954876488 3:53806032-53806054 AGGAGGGAACATGAGGGAGGAGG - Intronic
954876495 3:53806055-53806077 ATGAGAGAAAATGAGGGAGGAGG - Intronic
955510923 3:59679524-59679546 ATGAGTAAGAAGGAGGAGGGTGG + Intergenic
956054462 3:65283921-65283943 ATGAGTGGTAAAGAGGAAGGAGG - Intergenic
956718194 3:72096693-72096715 CTGGGTGAACAGGAGCATGGTGG - Intergenic
957542499 3:81591674-81591696 GTGAGAGAAGAGGAGGTAGGAGG - Intronic
958871300 3:99562228-99562250 AGGAGAGAACAGAAGAAAGGAGG - Intergenic
959107291 3:102079121-102079143 ATGAGTGGAGAGGAGGAAGCTGG - Intergenic
959407628 3:105979691-105979713 ATGAGTTAAAAGTAGGGAGGTGG - Intergenic
960223875 3:115147458-115147480 ATGAGGGAAGAGGAAGAAAGGGG - Intergenic
960257442 3:115525962-115525984 ATCAGCCAAGAGGAGGAAGGAGG - Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
961514549 3:127424576-127424598 ATGTGTGAACAGGGAGAGGGAGG - Intergenic
961522733 3:127476653-127476675 GGGAGAGAAGAGGAGGAAGGTGG + Intergenic
961523784 3:127483817-127483839 CTGAGTCAAGAGGAGGGAGGAGG + Intergenic
961745231 3:129060323-129060345 TTGAGTATACAGGAGGAGGGAGG + Intergenic
961953492 3:130775002-130775024 ATAAATGCACAGGAAGAAGGGGG + Intergenic
963063491 3:141243428-141243450 ATCAGTGAACAGGGTGGAGGAGG - Intronic
963341972 3:144047137-144047159 TTGAGTAAAAAGGAGGAGGGAGG - Intronic
963559907 3:146851310-146851332 ATGAAGGAAAAGGAGAAAGGAGG + Intergenic
963602664 3:147391453-147391475 ATGAGCCCAGAGGAGGAAGGCGG - Intronic
964676694 3:159290290-159290312 ATGTAAGAACAGCAGGAAGGGGG + Intronic
965074478 3:163959290-163959312 AGGAGTCCACAGGAGGAATGTGG - Intergenic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966351251 3:179034619-179034641 ATGGATGACCAGGAGGAAGCTGG - Intronic
967167765 3:186798455-186798477 ATGAATGGACAGGAAGAGGGAGG - Intronic
967807451 3:193728430-193728452 ATCAGTGATGAGGAGGATGGGGG + Intergenic
968190920 3:196666507-196666529 ATGCGTGGACATGAGGAAGAAGG + Intronic
968914350 4:3490741-3490763 AGGAATGAGCAGGAGGAAGAAGG - Intronic
968914403 4:3491000-3491022 ATGAATGAGCAGGAAGAAGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969170574 4:5359408-5359430 TTGAGTGCACAGGTGGATGGAGG - Intronic
969212365 4:5697508-5697530 GTGAGGGAGCTGGAGGAAGGAGG + Intronic
969442952 4:7227977-7227999 ATGACTGAACGGGAGCAAGCGGG + Intronic
969545560 4:7824748-7824770 CTGAGGGAACGGGAGGAAGGGGG + Intronic
969884421 4:10202473-10202495 CTGAGGGAACAGGTTGAAGGTGG + Intergenic
971640594 4:29127184-29127206 AAGAGAGAAAAGGAGGAAAGGGG + Intergenic
972171406 4:36350103-36350125 TTGAGTACACAGGAGGAGGGTGG - Intergenic
972569483 4:40297186-40297208 ATGAGAGTACAGCAAGAAGGTGG + Intergenic
973157750 4:46978240-46978262 ATGAGTGAGAAGGAGGCAGAAGG + Intronic
976021832 4:80638964-80638986 ATTAGGGCACAGGAAGAAGGTGG - Intronic
978407153 4:108392339-108392361 ATCAGAGAACATGAGGAAGGTGG - Intergenic
979363802 4:119796265-119796287 AAGAGAGAGTAGGAGGAAGGGGG + Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
979778906 4:124624807-124624829 ATGAGAGAAGAGAAGGGAGGAGG - Intergenic
979929502 4:126612859-126612881 ATGATTAAATAGGAGCAAGGAGG - Intergenic
980291937 4:130855422-130855444 ATCAGTGGCCAGGAGCAAGGTGG - Intergenic
980619782 4:135285683-135285705 ATTAGTGAAGAGAATGAAGGTGG + Intergenic
981264458 4:142765497-142765519 ATCAGTAGACAGGTGGAAGGTGG + Intronic
981975155 4:150719213-150719235 ATGAGAGAGAACGAGGAAGGTGG - Intronic
982154188 4:152499610-152499632 ATGAGAAAACAGGAAGGAGGGGG - Intronic
982381210 4:154750505-154750527 ATGAGTGAATATGGGGAGGGCGG + Exonic
984017523 4:174443590-174443612 AGGAGGGAAGAAGAGGAAGGAGG - Intergenic
984556097 4:181215675-181215697 ATGTGTGTACAGGAGAAACGGGG + Intergenic
984707866 4:182861083-182861105 ATGAGGGAAAAGGAGGGAGACGG - Intergenic
984930298 4:184841361-184841383 ATGAGTGGTCAGGCAGAAGGAGG + Intergenic
985413468 4:189711638-189711660 AGGAGTGAAGAGCAGGAAGGTGG - Intergenic
985919872 5:2961950-2961972 ATGGTTGAACAGGAGGATGAAGG + Intergenic
986035583 5:3933915-3933937 GTGAGAGAAGAGGTGGAAGGTGG + Intergenic
986599670 5:9459226-9459248 GAGTGTGAACAGGAGGAAGCAGG - Intronic
986664068 5:10084816-10084838 ATGAGGGTACAGGAAGCAGGTGG - Intergenic
986770271 5:10966527-10966549 GTGAGTGAACGGGAGGTAGGAGG - Intergenic
986788150 5:11134127-11134149 AGGAGGGAGCAGGAGAAAGGGGG + Intronic
986955494 5:13145359-13145381 ATGAATGGCCAGCAGGAAGGGGG + Intergenic
987002670 5:13675969-13675991 GTGGATGAACAGGAGGCAGGTGG + Intergenic
987858457 5:23452104-23452126 TTGAGTGAAGAGGAAGAAAGTGG + Intergenic
988174323 5:27701877-27701899 ATGAGTAAACAGGAAGACTGAGG + Intergenic
988474517 5:31572084-31572106 ATGAGCAAACAGGAAGAAGAGGG + Intergenic
988497231 5:31755825-31755847 ATGAGTGGGCAGGAGAGAGGAGG + Intronic
988720736 5:33876591-33876613 AAGAGAGAAAAGGAGGGAGGAGG + Intronic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
990793965 5:59519117-59519139 AGAAGGGAAGAGGAGGAAGGAGG - Intronic
990852930 5:60227573-60227595 AGGAGAGGAAAGGAGGAAGGGGG + Intronic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991023746 5:62008031-62008053 GTAAGTGAAGAGGATGAAGGAGG + Intergenic
991300018 5:65121023-65121045 ATGAGTGATCAGGAAGCTGGAGG + Intergenic
991516239 5:67438753-67438775 ATGAGTGAACTTCAAGAAGGAGG - Intergenic
991596822 5:68315054-68315076 ATTAGGAAACAGGAGAAAGGTGG + Intergenic
992034967 5:72764169-72764191 AGGAGGGAAAAGGAGGATGGAGG - Intergenic
992424292 5:76640357-76640379 ATGAGAAAAAAGGAAGAAGGGGG - Intronic
994269276 5:97757982-97758004 AGGTGTGTACAGGAGGAAGATGG - Intergenic
994738229 5:103584819-103584841 ATGAGTGAACAAGAACAAGATGG + Intergenic
996060839 5:119031625-119031647 AAGAATGAACAGGAGGATGTGGG - Intergenic
997265273 5:132491331-132491353 GTGAGTGACCTGGAGGGAGGGGG - Intergenic
998005061 5:138651303-138651325 AGGAGGGAGCGGGAGGAAGGTGG + Intronic
998731025 5:145077331-145077353 AGCAGACAACAGGAGGAAGGGGG - Intergenic
998931902 5:147190577-147190599 ATGAGTGACCATGTGGAGGGAGG - Intergenic
999247007 5:150160421-150160443 CTGAGTGTCCAGGAGGTAGGGGG - Intergenic
999684364 5:154089030-154089052 GGGTGTGAACTGGAGGAAGGGGG + Intronic
1000552244 5:162681463-162681485 ATAAGAGAAAAGGAAGAAGGAGG + Intergenic
1000821740 5:165993309-165993331 AAGAGTGGCCAGGAGGAAGGAGG - Intergenic
1001132964 5:169079742-169079764 AGGAGAGAAGAGGAGGAAGAGGG + Intronic
1001365312 5:171132280-171132302 AGGAGAGAAAAGAAGGAAGGAGG + Intronic
1001475011 5:172044336-172044358 CTGGGAGAACAGGAGGAATGAGG + Exonic
1001487444 5:172129540-172129562 ATGAATGAACAAGTGGATGGAGG - Intronic
1005275395 6:24211585-24211607 GTGAGTGAAAAAGAGGAAGGAGG + Intronic
1005500635 6:26426268-26426290 ATGAGAGACCACGAGGACGGGGG + Intergenic
1006212187 6:32405294-32405316 ATAAGTGAAAAAGAGGAACGAGG + Intronic
1006656865 6:35602703-35602725 AACAGTGCAGAGGAGGAAGGCGG - Intronic
1006673215 6:35742989-35743011 ACGAGGGAACAGCAGCAAGGGGG - Intronic
1006818831 6:36874470-36874492 ATGAGCGGACTGGGGGAAGGAGG + Intronic
1007386615 6:41524368-41524390 AGGAGTGAAAAGGGGGAAGAGGG + Intergenic
1009315344 6:62212382-62212404 ATGAGAGATAAGGAGGAAAGGGG + Intronic
1009364800 6:62849681-62849703 ATAATTGAACAGGCTGAAGGAGG - Intergenic
1010419769 6:75659784-75659806 ATGGGTAGGCAGGAGGAAGGAGG - Intronic
1010575944 6:77531329-77531351 ATGAGAGAATAAGAGAAAGGAGG + Intergenic
1011030628 6:82919082-82919104 ATGGGTGAAGAGGAAGAAAGTGG - Intronic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011566966 6:88685550-88685572 AGGAGGGAAAAGGAGGAAAGAGG + Intronic
1011617730 6:89212380-89212402 ATGATGGAACACCAGGAAGGGGG - Intronic
1011652432 6:89518957-89518979 ATGAGAACACAGGAAGAAGGTGG - Intronic
1012012051 6:93801282-93801304 GTGAGCGCACAGCAGGAAGGTGG - Intergenic
1012144049 6:95659144-95659166 GTGAGGGGACAGGAGGAGGGGGG + Intergenic
1012171151 6:96017443-96017465 ATGAATGAATATGAGCAAGGGGG + Intronic
1013619143 6:111872423-111872445 AAGAGTGAAGGGGAGGATGGGGG + Intronic
1013783716 6:113756268-113756290 GTGAGTGAACAGGTGGATGAGGG - Intergenic
1014089243 6:117384819-117384841 ATTAGAGGGCAGGAGGAAGGAGG + Intronic
1014270622 6:119331894-119331916 ATGAGTGCACAAGAAGAGGGTGG + Intronic
1014785650 6:125615711-125615733 AAGAGGGAACAGGAAGATGGTGG - Intergenic
1015000589 6:128209673-128209695 ATGAGTGAGCAAAAGGAAAGGGG + Intronic
1015216143 6:130752013-130752035 ATGAGTTGACACGAGGGAGGGGG - Intergenic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1016319537 6:142827676-142827698 AGGAGTGGGAAGGAGGAAGGAGG + Intronic
1016461911 6:144286469-144286491 CTGAGGGGACAGGAGGAGGGGGG + Intronic
1016678468 6:146799716-146799738 ATGTGTGTGTAGGAGGAAGGGGG + Intronic
1017082500 6:150682893-150682915 ATGAGAGAACAGCAGGAGTGAGG + Intronic
1017743520 6:157427168-157427190 CTGGGAGCACAGGAGGAAGGAGG + Intronic
1017837811 6:158195184-158195206 ATGACTTAACTGGAGGCAGGAGG + Exonic
1017865771 6:158441991-158442013 ATAACTGAAAAGCAGGAAGGGGG - Intronic
1018038063 6:159898610-159898632 AAGAGGGAGGAGGAGGAAGGAGG - Intergenic
1018650193 6:165986581-165986603 TTGAAGGAAAAGGAGGAAGGAGG - Intronic
1019224474 6:170498780-170498802 ATGCGTGAACAGAATGAAGGGGG + Intergenic
1019619689 7:1985590-1985612 AGGAGAGAACATGAGGATGGCGG - Intronic
1019760765 7:2810939-2810961 ATGAGATAACATGTGGAAGGAGG + Intronic
1019776155 7:2913150-2913172 AAGAGGGAAGAGGAGGAAAGAGG + Intronic
1019956295 7:4417261-4417283 ATCAGTGAAGTGGAGGAAGCTGG - Intergenic
1020485189 7:8712757-8712779 ATGTGTGACCATGAGCAAGGAGG - Intronic
1021928278 7:25554113-25554135 ATGAGTCAAGAGGAGGATGGGGG - Intergenic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023059227 7:36312879-36312901 TTGTGTGAACCTGAGGAAGGAGG + Intergenic
1023579059 7:41662279-41662301 ATGTGTGAAAAGGAGTGAGGGGG + Intergenic
1024019550 7:45353361-45353383 GGGAGGGAAGAGGAGGAAGGGGG + Intergenic
1024307944 7:47943887-47943909 GTGAGTGAGCAGCAGGAATGGGG - Intronic
1024827141 7:53404016-53404038 GTGAGTAAACAGGAAGAAGGTGG + Intergenic
1025198674 7:56949335-56949357 TTGAGGGAGGAGGAGGAAGGAGG - Intergenic
1025673274 7:63627596-63627618 TTGAGGGAGGAGGAGGAAGGAGG + Intergenic
1026116793 7:67502599-67502621 ATGAGGACACAGCAGGAAGGTGG - Intergenic
1026849132 7:73714060-73714082 ATGGGAGAAGAGGAGGAAGATGG - Intronic
1026944481 7:74307056-74307078 AATAGTGAACAGGAAGAAGGGGG - Intronic
1027007358 7:74706766-74706788 AGGAGTGCAGAGAAGGAAGGTGG - Intronic
1027839924 7:83296508-83296530 ATGTGTTAACAGGAAGAGGGGGG - Intergenic
1028903613 7:96128571-96128593 ACGGGGGATCAGGAGGAAGGTGG + Intronic
1029438402 7:100574786-100574808 GGGAGGGCACAGGAGGAAGGGGG + Exonic
1029607750 7:101609307-101609329 CTGAGAGGCCAGGAGGAAGGAGG - Intergenic
1029625375 7:101717586-101717608 ATGTGAGAACAGGCAGAAGGGGG - Intergenic
1029709677 7:102292857-102292879 GTGAGGGTGCAGGAGGAAGGGGG + Intronic
1030470615 7:109958453-109958475 ATGAGTGACCTGGAGCATGGGGG + Intergenic
1030560847 7:111083981-111084003 AAGAGTGAACAGTAAGAAGTAGG + Intronic
1030667841 7:112300797-112300819 CTGAGTGACCAGGAGAATGGTGG - Intronic
1031049663 7:116932188-116932210 CTGAGTGCACAAGAGTAAGGGGG - Intergenic
1031187368 7:118500088-118500110 AGGTGTGGACAGGAGGGAGGTGG - Intergenic
1032762453 7:134956506-134956528 ATGAGGACACAGCAGGAAGGTGG + Intronic
1032879176 7:136070791-136070813 ATCAGTGAAAATGAGGCAGGAGG + Intergenic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1033248901 7:139741717-139741739 ATGAATGCACAGGAGACAGGAGG - Intronic
1033653006 7:143356124-143356146 AAGAGTGAAATGGAGAAAGGAGG + Exonic
1033711320 7:143949598-143949620 ATGAGTGCACAGGTAGATGGTGG + Intergenic
1034332694 7:150296669-150296691 ATGTATGAACTGGAGGTAGGGGG - Intronic
1034665343 7:152813207-152813229 ATGTATGAACTGGAGGTAGGGGG + Intronic
1036491957 8:9235677-9235699 ATGAGTGTACATGAGGAAATGGG + Intergenic
1036599130 8:10242937-10242959 ATGAATGACCAGGATGCAGGTGG - Intronic
1036750515 8:11440883-11440905 ATGAGTTAAGAGGATGAATGAGG + Intronic
1036896990 8:12644151-12644173 ATGAGTGAATAGGTGGATAGAGG + Intergenic
1037420037 8:18692454-18692476 AAGAATGAACAGGAGAAAAGAGG + Intronic
1037540872 8:19869683-19869705 AGGAGGGAACTGCAGGAAGGTGG + Intergenic
1038311601 8:26449646-26449668 AGGGGTGAGCAGGAGGAGGGAGG + Intronic
1041371556 8:57166021-57166043 ATCCCTGAACAGGATGAAGGGGG - Intergenic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1042905273 8:73766162-73766184 GTGAATGCATAGGAGGAAGGCGG + Intronic
1043352959 8:79382755-79382777 ATGTTTGAAGAGGAGGAAGGAGG - Intergenic
1044429745 8:92095281-92095303 AGGGGTGGCCAGGAGGAAGGGGG - Intronic
1044700276 8:94959353-94959375 AGGCTTGAAGAGGAGGAAGGAGG + Intronic
1046953611 8:120041491-120041513 AAGAGTTAACAGGAAGCAGGAGG - Intronic
1047355540 8:124118314-124118336 TTGAGGGAACAGGAAGAGGGAGG + Intronic
1047616956 8:126570529-126570551 ATGAGTTAACCGGAGCCAGGAGG + Intergenic
1048529672 8:135235949-135235971 ATGAGTGAACTTCAGGAAGGGGG - Intergenic
1048572399 8:135666907-135666929 ATGAGTGAATGGGAAGGAGGGGG + Intergenic
1048787959 8:138071729-138071751 ATGAGTGAACAGGTGGGTAGAGG + Intergenic
1049291419 8:141804866-141804888 ATGCGTGAACAGGAGAAAAGGGG + Intergenic
1049933517 9:478585-478607 AGGAGTGAGCAGGAGAAAGTGGG - Intronic
1050339340 9:4620259-4620281 ATGAGGCCACAGGAGGAAGGAGG - Intronic
1050339350 9:4620300-4620322 ATGAAGCCACAGGAGGAAGGAGG - Intronic
1050867847 9:10526631-10526653 ATTAAAGAACAGGAGTAAGGAGG - Intronic
1051033724 9:12717300-12717322 ATCAGTGATCATGATGAAGGGGG - Intergenic
1051867811 9:21700982-21701004 ATGATTGCTCAGAAGGAAGGGGG - Intergenic
1052037720 9:23701905-23701927 AAGAGTGTACGGGAGGGAGGTGG - Intronic
1053456598 9:38237865-38237887 ATGGGTGAACAGGATGGAAGAGG - Intergenic
1053719979 9:40935648-40935670 AGGTGTGAACGGGAGGCAGGAGG + Intergenic
1054710280 9:68504238-68504260 AGGAGTGCACAGGAGGCTGGCGG - Intronic
1054770442 9:69078435-69078457 CTGAGAGAAAAGGAGGAAGGTGG - Intronic
1054880212 9:70136634-70136656 ATGAAAAAAAAGGAGGAAGGGGG + Intronic
1055742086 9:79401255-79401277 AGGAGTGGATAGAAGGAAGGAGG - Intergenic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056608017 9:88103364-88103386 ATGAGGAAAGAGGAGGAAGATGG - Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056906142 9:90649547-90649569 ATGAGGACACAGCAGGAAGGTGG + Intergenic
1057167273 9:92938889-92938911 ATGAGTGAGCAAGAGGAAGAAGG - Intergenic
1057321182 9:94014444-94014466 GTGAGTTAACAGGGGGAGGGAGG - Intergenic
1057521917 9:95766887-95766909 ATGAGTGACCCTGAGGGAGGGGG + Intergenic
1057557040 9:96096260-96096282 ATGAGTGACCAAGGGTAAGGAGG - Intergenic
1057840504 9:98482121-98482143 ATGGATGAACTGCAGGAAGGTGG - Intronic
1057999732 9:99852745-99852767 AAGACTGAGAAGGAGGAAGGAGG + Intronic
1058595534 9:106611363-106611385 ATGAAAGAACTGGAAGAAGGAGG + Intergenic
1058708014 9:107653353-107653375 ATGAGTGACCAGGAGGGTGGAGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059684763 9:116624491-116624513 ATGAGAATACAGAAGGAAGGGGG + Intronic
1060210058 9:121704693-121704715 AGGAGAGGACGGGAGGAAGGTGG - Intronic
1061074452 9:128332651-128332673 AAGAGTGAACAGAAGGGAGTAGG - Intronic
1061504693 9:131025285-131025307 ATGAGGGAAGAGGAGGAATTGGG + Intronic
1061532505 9:131225898-131225920 GGGAGAGGACAGGAGGAAGGTGG + Intronic
1061595703 9:131627882-131627904 ACGATGGAACAGGAGGATGGTGG + Intronic
1062100628 9:134726560-134726582 ATGAGTGGACAGACGGATGGAGG + Intronic
1062112300 9:134788765-134788787 ATGAGTAGACAGGTGGATGGTGG + Intronic
1062185651 9:135216873-135216895 GTGAGTGAGGAGGGGGAAGGGGG + Intergenic
1062405636 9:136394973-136394995 ACGGGAGAACAGGAGGCAGGGGG - Intronic
1062673823 9:137728064-137728086 AGGAATGAGCAGGAGGGAGGAGG - Intronic
1203639488 Un_KI270750v1:146751-146773 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1185608514 X:1380612-1380634 ATGAGTGGGGAGGGGGAAGGAGG + Intronic
1185853110 X:3507594-3507616 ATGAATGACCAGGATGAATGTGG + Intergenic
1186047145 X:5548779-5548801 ATGGATGAAGAGGAGGAAGAAGG - Intergenic
1186732510 X:12425208-12425230 AAGACTAAACAGGAGGAAGGTGG - Intronic
1187377118 X:18764980-18765002 AAGATTGAACAGGAGGAGGTGGG + Intronic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1188464831 X:30467873-30467895 ATGAGTAAAAAGGAGAAATGAGG - Intergenic
1189681193 X:43518442-43518464 AGGAGTGAATAGGGAGAAGGTGG + Intergenic
1190947676 X:55111676-55111698 ATAATTGAACAGGCTGAAGGCGG + Intronic
1192093345 X:68184219-68184241 ATGAGTCAAAAAGAGGAATGGGG + Intronic
1192215676 X:69156585-69156607 GGGAGGAAACAGGAGGAAGGGGG + Intergenic
1193189158 X:78548960-78548982 ATGACTGAACAATAGGAAAGTGG + Intergenic
1195279617 X:103318350-103318372 ATCAGTGAACAAAGGGAAGGAGG + Intergenic
1196286049 X:113881826-113881848 ATTATTGAACACGAGGAGGGAGG - Intergenic
1196315159 X:114213667-114213689 AAGAGAGAGAAGGAGGAAGGAGG + Intergenic
1197154881 X:123259449-123259471 AGGAGTGGAGAGGAGAAAGGAGG - Intronic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1197752678 X:129976304-129976326 AGGAGTGAAAATGAGGAAAGGGG - Intergenic
1198503661 X:137279952-137279974 TTGAGTGAAGAGGGAGAAGGTGG + Intergenic
1198957503 X:142148694-142148716 ATCAGTGCAGAGGAGGATGGGGG + Intergenic
1199807616 X:151316078-151316100 AATGGTGAACAGGAGGTAGGAGG - Intergenic
1200120238 X:153786749-153786771 GTCTGTGAACAGGAGAAAGGCGG + Intronic
1200745460 Y:6900129-6900151 ATAATTGAACAGGCTGAAGGTGG + Intergenic
1200833972 Y:7714625-7714647 ATGAGGAAACAGCAGGAATGTGG + Intergenic
1201382258 Y:13394778-13394800 ATGAGTGAGGAGAAGCAAGGAGG - Intronic
1201618307 Y:15926517-15926539 ATAATTGAACAGGCTGAAGGTGG + Intergenic