ID: 1153815401

View in Genome Browser
Species Human (GRCh38)
Location 18:8786120-8786142
Sequence CAGAAAAAGGAGGGGGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2362
Summary {0: 1, 1: 1, 2: 19, 3: 259, 4: 2082}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153815401_1153815412 15 Left 1153815401 18:8786120-8786142 CCGCCCTCCCCCTCCTTTTTCTG 0: 1
1: 1
2: 19
3: 259
4: 2082
Right 1153815412 18:8786158-8786180 GACGTTTTCTGTCCCGGACGAGG 0: 1
1: 0
2: 1
3: 1
4: 18
1153815401_1153815411 9 Left 1153815401 18:8786120-8786142 CCGCCCTCCCCCTCCTTTTTCTG 0: 1
1: 1
2: 19
3: 259
4: 2082
Right 1153815411 18:8786152-8786174 CTGTGTGACGTTTTCTGTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 134
1153815401_1153815413 23 Left 1153815401 18:8786120-8786142 CCGCCCTCCCCCTCCTTTTTCTG 0: 1
1: 1
2: 19
3: 259
4: 2082
Right 1153815413 18:8786166-8786188 CTGTCCCGGACGAGGCCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 125
1153815401_1153815414 24 Left 1153815401 18:8786120-8786142 CCGCCCTCCCCCTCCTTTTTCTG 0: 1
1: 1
2: 19
3: 259
4: 2082
Right 1153815414 18:8786167-8786189 TGTCCCGGACGAGGCCCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153815401 Original CRISPR CAGAAAAAGGAGGGGGAGGG CGG (reversed) Intronic
Too many off-targets to display for this crispr