ID: 1153815607

View in Genome Browser
Species Human (GRCh38)
Location 18:8787453-8787475
Sequence TCCCCAGCACATCCCCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153815599_1153815607 -6 Left 1153815599 18:8787436-8787458 CCAGCTGCAGCCCCCGCTCCCCA 0: 1
1: 0
2: 8
3: 118
4: 883
Right 1153815607 18:8787453-8787475 TCCCCAGCACATCCCCGGAGGGG 0: 1
1: 0
2: 2
3: 13
4: 186
1153815598_1153815607 -2 Left 1153815598 18:8787432-8787454 CCAGCCAGCTGCAGCCCCCGCTC 0: 1
1: 0
2: 7
3: 75
4: 508
Right 1153815607 18:8787453-8787475 TCCCCAGCACATCCCCGGAGGGG 0: 1
1: 0
2: 2
3: 13
4: 186
1153815597_1153815607 1 Left 1153815597 18:8787429-8787451 CCTCCAGCCAGCTGCAGCCCCCG 0: 1
1: 0
2: 6
3: 67
4: 568
Right 1153815607 18:8787453-8787475 TCCCCAGCACATCCCCGGAGGGG 0: 1
1: 0
2: 2
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153815607 Original CRISPR TCCCCAGCACATCCCCGGAG GGG Intronic
900004608 1:36491-36513 TCCCCAACACATCCCCCAACAGG + Intergenic
900024331 1:207010-207032 TCCCCAACACATCCCCCAACAGG + Intergenic
900097903 1:947774-947796 TCCCCAGGCCATCCCGGGTGTGG - Intronic
901656777 1:10773917-10773939 TCCCCAACCCATCTCTGGAGAGG - Intronic
902358362 1:15925183-15925205 TCCCCAGCCCAGCCCCTTAGTGG - Intronic
902990875 1:20186235-20186257 ACCCCAGCACATCACCCGGGAGG + Intronic
905803526 1:40860931-40860953 TCCCCAGCAGTGCCCAGGAGAGG - Intergenic
906993646 1:50766456-50766478 TCTTCAGCACTTCCCCAGAGTGG - Intronic
907568227 1:55457455-55457477 TCTCCACCACATCCCCAGGGGGG - Intergenic
908118401 1:60963301-60963323 TCCTCTGCACACCCCAGGAGAGG + Intronic
909982265 1:82116781-82116803 TCCCCTGCACCTCCCCTGGGAGG - Intergenic
911091659 1:94022203-94022225 TCCTCAGCCCTTCCCTGGAGTGG + Intronic
914941071 1:152023423-152023445 TCCCCTGCACATTCCTGGGGAGG + Intergenic
916139721 1:161685102-161685124 TCACAAGCACATCCATGGAGTGG - Intergenic
916717976 1:167461077-167461099 TCCCCAGCATGTCCCCAGCGTGG - Intronic
918238830 1:182604215-182604237 TCCCCACCACCTGCCTGGAGAGG - Exonic
920363653 1:205436501-205436523 ACCCCAGGCCATCCCTGGAGTGG - Intronic
922469612 1:225867885-225867907 TACCCAGCAAGTCCCCTGAGAGG + Exonic
922790707 1:228309361-228309383 TCCCCAGCACAACCCCCTTGTGG - Intronic
924342602 1:243050982-243051004 TTCCCAGCACATGGCCGGTGAGG + Intergenic
1063614431 10:7589868-7589890 TCCCCGGCTCCTCCCTGGAGGGG + Intronic
1067043938 10:42974179-42974201 TCCTCAGCACATCCCCTGCCAGG - Intergenic
1068690035 10:59905821-59905843 CCTCCAGCCCAGCCCCGGAGGGG + Intronic
1070920570 10:80183043-80183065 TCCCCAGCCCATGCCAGGAGGGG - Intronic
1074795586 10:116939431-116939453 TCCCCTGCACTTCCCGGGTGAGG + Intronic
1074877062 10:117621811-117621833 TCCCCATCACATACTTGGAGGGG + Intergenic
1076206271 10:128606929-128606951 TCCCCAGCAGATCCGCGTGGAGG + Intergenic
1076842450 10:133052451-133052473 TGCCCACCACATCTCAGGAGAGG - Intergenic
1077967754 11:7153777-7153799 TCCATGGCACATCCCCAGAGAGG + Intergenic
1084116453 11:67045479-67045501 TCCCCAGAGCATCCTAGGAGGGG + Intronic
1084657454 11:70527692-70527714 TCACCACCACATCCCCTGAGAGG - Intronic
1084961935 11:72721426-72721448 TCCCCAACGAATCCCCAGAGGGG + Intronic
1089418849 11:118315941-118315963 TACCCAGTCCATCCCCAGAGAGG - Exonic
1089442433 11:118528681-118528703 ACCTCAGCACAGCCCTGGAGAGG + Exonic
1091005551 11:131950096-131950118 TCCACACCACATCCCAGTAGTGG + Intronic
1091378028 12:38545-38567 TCCCCAACACATCCCCCAACAGG + Intergenic
1093717211 12:22397029-22397051 TCCCTTGCATATCCCTGGAGTGG + Intronic
1095991534 12:48037835-48037857 TCCCCAGGTCATCCCCAGAGAGG + Intergenic
1097041802 12:56160447-56160469 TGCCCAGCCCAGCCCAGGAGTGG + Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1099574265 12:84361629-84361651 TCCCCAGGCCCTCCCCGCAGTGG - Intergenic
1101889876 12:108703743-108703765 TCCCCAGCAGAAGCCAGGAGAGG + Intronic
1102514112 12:113435179-113435201 TCCCCATCCCATCCACGGTGAGG - Intronic
1103563211 12:121803469-121803491 TCCCCAGCTCAGCTCCGGGGAGG + Intergenic
1104518024 12:129445931-129445953 TCCTCAGCGTATCCCCGGGGAGG + Intronic
1104559506 12:129831180-129831202 TCACCAGCACATCACTGAAGGGG + Intronic
1105508827 13:21034412-21034434 TCCCCAACACCTCCCCGGTCAGG - Intronic
1107728546 13:43324787-43324809 TCCCCACCACACCCACGCAGAGG + Intronic
1109220672 13:59638071-59638093 TCCTCAGAACATCCCCGGTGGGG + Intergenic
1118726625 14:68633465-68633487 TCCGCAGCCCACCCCTGGAGAGG + Intronic
1118849754 14:69574307-69574329 TCCCCAGCAAACACCCGGTGGGG - Intronic
1119424205 14:74525139-74525161 TCACCAGCACATCAGTGGAGGGG + Exonic
1119538642 14:75423922-75423944 TCCCAAGCTCTTCCCTGGAGTGG - Intergenic
1120137203 14:80884533-80884555 TCCCTTGCACTTCCCCGGTGAGG - Intronic
1121260071 14:92559527-92559549 TCCCCACCAGACCCTCGGAGAGG - Intronic
1121302402 14:92881810-92881832 TCCCAAGCCCATCCCCAGAAGGG - Intergenic
1121457318 14:94046736-94046758 TCCCCAGCAAATCCTAGAAGTGG + Exonic
1121856750 14:97277272-97277294 TCCCCAACCCAGACCCGGAGAGG + Intergenic
1122130997 14:99604437-99604459 CCTCCCGCACACCCCCGGAGCGG - Intergenic
1122305419 14:100763049-100763071 TCCCCATCACATCCAGGAAGTGG - Intergenic
1123224081 14:106883671-106883693 ACGCCGGCGCATCCCCGGAGGGG - Intergenic
1128743121 15:70096844-70096866 TCCCCCGCACCTCCCCGGCCCGG - Exonic
1129499232 15:76019609-76019631 TCCCTTGCACTTCCCCGGTGAGG + Intronic
1131473872 15:92719455-92719477 TCCCAAGCACATCCAGGGAGTGG + Intronic
1131786750 15:95921622-95921644 TCCCCAGGACATTCCTGGGGAGG + Intergenic
1132448900 15:101954452-101954474 TCCCCAACACATCCCCCAACAGG - Intergenic
1132525299 16:411279-411301 CCCCCAGCTCATTCCCTGAGAGG - Intronic
1132626697 16:894799-894821 ACCCCAGCACGCCCACGGAGGGG - Intronic
1132857574 16:2053678-2053700 TCCCCAGAACATCCCATAAGAGG - Intronic
1133222387 16:4324273-4324295 GGCCCAGCAGATCCCAGGAGAGG - Intronic
1133840919 16:9408533-9408555 TCCCCTGCTGATCCTCGGAGAGG + Intergenic
1135653752 16:24229586-24229608 TCCCCAACTCAGCCCCTGAGAGG - Intergenic
1136861585 16:33707455-33707477 TCCTCAGCACAAACCCGGACGGG + Intergenic
1138432467 16:56977841-56977863 TCCTCAGCACATCCTGAGAGAGG + Intronic
1138553937 16:57761523-57761545 TCCCTAGCAGGTCCCTGGAGGGG + Exonic
1139429432 16:66903335-66903357 TCTCCACCACAGCCCAGGAGAGG + Intergenic
1139924106 16:70476356-70476378 ACCCCAGCACAGCCCTGGAAAGG - Intronic
1141950477 16:87336099-87336121 TCCCCAGCACACACCAGGAGAGG + Intronic
1142050083 16:87952055-87952077 ACCCCAGCCCGTCCCCCGAGGGG + Intronic
1142112848 16:88341385-88341407 TGCCCAGCACGTCCCAGCAGGGG - Intergenic
1143431952 17:6894205-6894227 TCCACAGCACAGCCGGGGAGAGG - Intronic
1144339620 17:14301098-14301120 GCCCCGGCACTTCCCCGCAGAGG - Exonic
1145722005 17:27082518-27082540 TCCCCGGCACCTCCCCGGCCAGG + Intergenic
1147375721 17:40021559-40021581 CCCCCAAAACATGCCCGGAGAGG - Intronic
1147409792 17:40241570-40241592 TCCCCTGTACATCCCAGGAGCGG - Intronic
1147994466 17:44353499-44353521 TCCCCGGCACCTCCCCGTGGGGG + Exonic
1148108003 17:45129749-45129771 TCCGCAGCCCAGCCCAGGAGCGG + Intronic
1148716168 17:49717665-49717687 GCCCCAGCTCCTCCCCAGAGTGG - Exonic
1151685397 17:75643319-75643341 TCCCCAGCCCAGCTGCGGAGAGG + Intronic
1152487373 17:80602818-80602840 TCACCAGCGCGTCCACGGAGTGG - Intronic
1152554923 17:81048406-81048428 ACCCCAGCACGGCCCAGGAGTGG + Intronic
1153815607 18:8787453-8787475 TCCCCAGCACATCCCCGGAGGGG + Intronic
1154388229 18:13914479-13914501 TCCCCACCCCATCCCCGGAGTGG - Intronic
1155376880 18:25168492-25168514 TCCCAAACACATACCAGGAGAGG + Intronic
1155507681 18:26548676-26548698 TCCCGAGCGCAGCTCCGGAGGGG + Intronic
1158783859 18:60685329-60685351 AACCCAGCACCTCTCCGGAGTGG - Intergenic
1159365879 18:67464894-67464916 TCCCCATCACAAGCCTGGAGTGG - Intergenic
1160636360 19:78100-78122 TCCCCAACACATCCCCCAACAGG + Intergenic
1160856891 19:1221768-1221790 TCCCCGGCATGTCCCAGGAGTGG + Intronic
1161029266 19:2050475-2050497 CCCCCAGAACATACCCGGCGGGG + Intronic
1161455887 19:4369564-4369586 TCCCCAGCCCCTCCCCTCAGAGG - Intronic
1162107272 19:8377601-8377623 TCCCCAGCACCTGCCAGGAAGGG - Intronic
1164911710 19:32017977-32017999 TTCCCAGCTCATCCCCTCAGAGG - Intergenic
925169667 2:1743462-1743484 CCCCCAGGACACCCCAGGAGAGG + Intronic
926303295 2:11618936-11618958 GCCCCAGCACAGCCCCGGACTGG + Intronic
928987339 2:37194632-37194654 TCACAAGCACATCCACAGAGTGG - Intronic
929000778 2:37345038-37345060 TCTCCAGAACAGCCCCGGACTGG - Intronic
929962211 2:46505335-46505357 CCTCCAGCACATCCTTGGAGTGG - Intronic
933260214 2:80123956-80123978 CCCCCAGCACAGCCCAGCAGGGG + Intronic
936565120 2:113576949-113576971 TCCCCAACACATCCCCCAACAGG - Intergenic
938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG + Intergenic
939317049 2:140565806-140565828 CTCCCAGCTCATCCCAGGAGAGG - Intronic
941610638 2:167657375-167657397 TCCCCAGCACACCCCTTGAATGG - Intergenic
943506685 2:188769292-188769314 TCCCCAGCCCCTCCCCAGAAAGG + Intronic
944296439 2:198068530-198068552 TGACCAGCACAACCCCTGAGAGG - Intronic
946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG + Exonic
947911598 2:233804229-233804251 ACCCCAGCACATACACGGATTGG - Intronic
948870174 2:240793883-240793905 TCCCCACGACATCCTCTGAGGGG + Intronic
1168760811 20:348177-348199 TCCCCAGCGCCTCGCCGGGGCGG + Intronic
1169073854 20:2749882-2749904 CCCGCGGCACATCCCCGGGGTGG + Exonic
1170590586 20:17768380-17768402 TCCCAAGCAGTTCCCAGGAGTGG + Intergenic
1171188908 20:23144512-23144534 TTCCCAGCACATCTCCGGGTAGG - Intergenic
1173180504 20:40803225-40803247 TCCTCAGCACTTCACCAGAGTGG + Intergenic
1176145145 20:63562178-63562200 TCCCCAGCAGGTTCCTGGAGCGG - Exonic
1176182043 20:63754185-63754207 CCCGCCGCACATCCCCCGAGTGG + Intronic
1176308220 21:5135475-5135497 GCCCCAGCCCAGCCCAGGAGTGG + Intronic
1176359990 21:5987240-5987262 TTCACAGCACATCCACAGAGTGG - Intergenic
1177694502 21:24554765-24554787 TCCCTTGCACATCCCGGGTGAGG - Intergenic
1179763528 21:43551310-43551332 TTCACAGCACATCCACAGAGTGG + Intronic
1179848840 21:44126557-44126579 GCCCCAGCCCAGCCCAGGAGTGG - Intronic
1179882765 21:44300345-44300367 TCCCCCGCTCTTCCCCGGCGCGG + Intronic
1179990756 21:44947170-44947192 GCCCCAGCACAAACCCGGGGTGG - Intronic
1181855721 22:25780205-25780227 CCCCTTGCACATCCCCCGAGAGG - Intronic
1183544530 22:38448533-38448555 TCCCCAGAAAATCCCCAGATCGG - Intronic
1183672813 22:39283118-39283140 TCCCCAGCACAGCCCAGGAGGGG - Intergenic
1184479097 22:44736794-44736816 TGGCCAGCACGTCCCCCGAGCGG - Exonic
1184525465 22:45020135-45020157 GCCGCATCACAACCCCGGAGAGG - Intergenic
1185430363 22:50807154-50807176 ACGCCGGCACCTCCCCGGAGGGG - Intergenic
950358947 3:12436968-12436990 CCCCCAGCACCTCCCTGGAACGG + Intergenic
951563293 3:23988961-23988983 GCCCCAGCACACCACTGGAGAGG - Intergenic
960254021 3:115491058-115491080 TCCCCAGCACTTAAGCGGAGGGG + Intergenic
960938022 3:122915314-122915336 TCCCTAGCACAGCCCTGAAGTGG + Intronic
969519610 4:7668345-7668367 TCCCCATCCCAGCCCCAGAGGGG - Intronic
971996222 4:33968260-33968282 TCACAAGCACATCCATGGAGTGG + Intergenic
978327467 4:107575512-107575534 CCCCCAGCACATGCCCTGTGAGG + Intergenic
986309326 5:6540188-6540210 GCACCAGCACATCACCTGAGAGG - Intergenic
986364712 5:7018960-7018982 TTCCCATCACATGCCCTGAGAGG - Intergenic
988196184 5:28009079-28009101 ACCCCACCACATCCACGGAATGG + Intergenic
990614499 5:57493633-57493655 TGCTGAGCACATCCCCGGAATGG + Intergenic
992618354 5:78568036-78568058 TCATCAGCACATCCCATGAGAGG - Intronic
996956463 5:129188411-129188433 TCCCCATCCCAGCCCTGGAGGGG - Intergenic
997733334 5:136196034-136196056 TTCCCTGCACATCCCCGGGCAGG + Intergenic
998130706 5:139649832-139649854 TCCCCTTCGCTTCCCCGGAGCGG + Intronic
1002377845 5:178801065-178801087 TCCTCCCCACATCCCTGGAGGGG - Intergenic
1003170614 6:3719154-3719176 TCCCCAGCACTTCCCTTGTGGGG - Intergenic
1007697889 6:43745060-43745082 TCCCCAGCTCATCCCCACAAAGG - Intergenic
1011807656 6:91090679-91090701 TCCCCTGCACATTGGCGGAGAGG + Intergenic
1014718034 6:124888148-124888170 TCCCCATCACATACCCTGCGAGG + Intergenic
1016004949 6:139079742-139079764 TCTCCAGCACCCCCCCGGTGAGG - Intergenic
1016838705 6:148504951-148504973 TCCCCAGTACTTCCCCTGAGCGG - Intronic
1016913986 6:149227641-149227663 CCCCCAGAACATCCCCAGTGAGG + Intronic
1018447888 6:163874786-163874808 TCCACAGCAAATCACAGGAGGGG + Intergenic
1019179943 6:170180155-170180177 TCCCCAGCACATCTCTGGCGCGG - Intergenic
1019351292 7:555209-555231 TCCTCAGCCCCTCCCCAGAGCGG - Intronic
1022364756 7:29701551-29701573 TCCCCACCCCATCCCCCGACAGG + Intergenic
1024075918 7:45817790-45817812 TTCCCAGCACATGGCCGGTGAGG - Intergenic
1024647682 7:51383502-51383524 TTCCCAGCACATGGCCGGTGAGG + Intergenic
1025078749 7:55964715-55964737 TCCCCGGCACCTCCCGGGAAGGG - Intronic
1027810394 7:82889159-82889181 TCCCCAGCACAACCCCCGTGTGG + Intronic
1027932326 7:84553135-84553157 TCCCCATCACATGCCCTGCGAGG + Intergenic
1032068488 7:128790474-128790496 TCCCCAGCACATCCAGGAAATGG - Intergenic
1034273483 7:149814327-149814349 TGCCCAGCACCTGCCTGGAGGGG + Intergenic
1034831857 7:154315615-154315637 TCCCTAGCACAGCCCCCCAGAGG - Intronic
1035233406 7:157480648-157480670 CCCCCTGCGCATCCCCGGCGTGG + Intergenic
1035388938 7:158492168-158492190 CCTCCAGCACATCTCCGGTGTGG - Intronic
1037744168 8:21629992-21630014 TCCCCAGCACAGCCCTGTGGGGG - Intergenic
1037769074 8:21788508-21788530 TCCCCTGCGCTTCCCAGGAGGGG + Exonic
1038249156 8:25886824-25886846 TCCCCGGCACATCCCAGGCGTGG - Exonic
1038590265 8:28831298-28831320 TCCCCCGCACACTCCCTGAGAGG - Intronic
1040564780 8:48555722-48555744 TCCCAGGCGCAGCCCCGGAGCGG - Intergenic
1047925692 8:129680305-129680327 TCCCCATCACATTCCCCAAGGGG + Intergenic
1048387003 8:133921524-133921546 TCCCCACCACATCCCCAGACAGG + Intergenic
1049494571 8:142923746-142923768 TTCCCAGCACGTCCTTGGAGTGG + Intergenic
1049887303 9:36274-36296 TCCCCAACACATCCCCCAACAGG + Intergenic
1053222099 9:36320635-36320657 TCCCCACCACACCCCTGGGGAGG - Intergenic
1055179285 9:73363454-73363476 TCCCCACCACATCCACAGACAGG - Intergenic
1057352510 9:94311237-94311259 ACCCTAGCACATCCCCTGTGAGG - Intergenic
1057655130 9:96944836-96944858 ACCCTAGCACATCCCCTGTGAGG + Intronic
1060930615 9:127487392-127487414 TCCCCAGCACCCCCCGGAAGTGG - Intronic
1061419710 9:130466600-130466622 TCTCCAGCATGTCCCCAGAGAGG - Intronic
1061870194 9:133516327-133516349 TCCCCAGCCCCTCCCAAGAGGGG - Intronic
1061959784 9:133982158-133982180 TCCCCTGCAGTTCCCTGGAGGGG - Intronic
1062066646 9:134531540-134531562 AACCCAGCCCCTCCCCGGAGTGG - Intergenic
1062640363 9:137515507-137515529 TCCCCAGCAGATCACGGGGGCGG - Exonic
1185565823 X:1094429-1094451 TCGCCAGCAAATCCCCAGAAGGG - Intergenic
1186960273 X:14728976-14728998 TCAACAGCAGATCCCTGGAGAGG - Intronic
1189262619 X:39689139-39689161 TCCCCGCCACAGCCCGGGAGGGG - Intergenic
1190714763 X:53094081-53094103 TCCCCAGCCAATCCCTGGAAAGG + Intergenic
1193600061 X:83500945-83500967 TCCTGAGCATATCCCCCGAGGGG + Intergenic
1195246718 X:103001784-103001806 TTCCCAGCAAAGCCCGGGAGAGG - Intergenic
1195433855 X:104819622-104819644 TGATCAGCACATCCCTGGAGAGG + Intronic
1199249062 X:145638368-145638390 CCCACTGCACATCCCCAGAGAGG + Intergenic