ID: 1153817153

View in Genome Browser
Species Human (GRCh38)
Location 18:8800450-8800472
Sequence CTGCATATACCGATCAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153817152_1153817153 -3 Left 1153817152 18:8800430-8800452 CCACAGAGGTTTAAAAAAAACTG 0: 1
1: 0
2: 3
3: 41
4: 436
Right 1153817153 18:8800450-8800472 CTGCATATACCGATCAACCTTGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153817153 Original CRISPR CTGCATATACCGATCAACCT TGG Intronic
902243916 1:15106815-15106837 CTGCATCTCCCGATAAACCTTGG + Intronic
910623065 1:89276962-89276984 TTGCATGGACCCATCAACCTGGG - Intergenic
1075488030 10:122842675-122842697 CTGAATTTATAGATCAACCTGGG + Intronic
1077165318 11:1132326-1132348 CTGTATATACCATCCAACCTGGG + Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1084596738 11:70121031-70121053 CTACATATACCGCTTGACCTCGG - Intronic
1095427190 12:42089052-42089074 CTGCATAAAACCATCACCCTTGG + Intronic
1099273712 12:80548541-80548563 CTGCCTACACCGCTCTACCTGGG - Intronic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1128947098 15:71832577-71832599 CTGTATATAACAATCAAGCTTGG - Intronic
1137485021 16:48883418-48883440 CTGCAGATCCCAATTAACCTTGG + Intergenic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1153817153 18:8800450-8800472 CTGCATATACCGATCAACCTTGG + Intronic
1158074234 18:53510279-53510301 TTGCATATGCTGTTCAACCTGGG - Intronic
932828273 2:74961252-74961274 CTGCATCTCCCTGTCAACCTAGG + Intronic
939707826 2:145477536-145477558 CAGCATATCCAGATCAACCCAGG - Intergenic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
951376566 3:21925266-21925288 CTGCCAATACCAAACAACCTTGG - Intronic
960053671 3:113261046-113261068 CTGCATACTCCCATCAGCCTCGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
984787530 4:183582782-183582804 CAGCACATACTGATCAATCTCGG - Intergenic
1002248842 5:177908682-177908704 TTGCATATAGGGATCAAACTGGG + Intergenic
1010040173 6:71372449-71372471 CTGAATCTACAGATCAACTTGGG + Intergenic
1019889129 7:3931660-3931682 CAGCATAGACCAATCAACCTAGG - Intronic
1022143114 7:27510480-27510502 CTGCAAATACCAGTCAAACTTGG + Intergenic
1022381412 7:29863637-29863659 TTGAATTTACAGATCAACCTGGG + Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1038865810 8:31437756-31437778 CTGAATTTACTGATCAGCCTTGG - Intergenic
1039516887 8:38141108-38141130 CTGCATTTACCTCTCTACCTCGG + Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046707264 8:117468787-117468809 CTTGATATACAGATCAATCTAGG + Intergenic
1049366242 8:142238211-142238233 CTGCACATTCTGAGCAACCTGGG - Intronic
1050681545 9:8117433-8117455 CTGACTATGCCCATCAACCTGGG + Intergenic
1051279582 9:15428295-15428317 CTGTTTATACAGATCAACTTTGG + Intronic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic