ID: 1153819676

View in Genome Browser
Species Human (GRCh38)
Location 18:8822783-8822805
Sequence CTGTGAACGGGGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 551}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153819676_1153819683 1 Left 1153819676 18:8822783-8822805 CCTCCCACCTTCCCCGTTCACAG 0: 1
1: 0
2: 3
3: 51
4: 551
Right 1153819683 18:8822807-8822829 AGCAGCCACATCAGTGTTTCCGG 0: 1
1: 0
2: 3
3: 22
4: 204
1153819676_1153819685 6 Left 1153819676 18:8822783-8822805 CCTCCCACCTTCCCCGTTCACAG 0: 1
1: 0
2: 3
3: 51
4: 551
Right 1153819685 18:8822812-8822834 CCACATCAGTGTTTCCGGTTAGG 0: 1
1: 1
2: 0
3: 5
4: 59
1153819676_1153819686 12 Left 1153819676 18:8822783-8822805 CCTCCCACCTTCCCCGTTCACAG 0: 1
1: 0
2: 3
3: 51
4: 551
Right 1153819686 18:8822818-8822840 CAGTGTTTCCGGTTAGGCTTTGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153819676 Original CRISPR CTGTGAACGGGGAAGGTGGG AGG (reversed) Intronic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
901778487 1:11576803-11576825 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
902162599 1:14543403-14543425 CTGTGAACTGTGAAGTTGGCTGG + Intergenic
902189898 1:14754996-14755018 CTGTGAGCGGCCAAGGCGGGAGG + Intronic
902509980 1:16961150-16961172 CAGGGAAGGGGGGAGGTGGGCGG + Intronic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903071150 1:20727515-20727537 CTGTGGGCGCTGAAGGTGGGTGG - Exonic
903157739 1:21459668-21459690 CTGGGAACGCTGAAGATGGGAGG + Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904064867 1:27741635-27741657 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
905073238 1:35246463-35246485 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
905153411 1:35951630-35951652 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
905857959 1:41327299-41327321 GGGAGAACGGGGAATGTGGGAGG + Intergenic
906640162 1:47436956-47436978 CTGGGAGCCAGGAAGGTGGGGGG + Exonic
907445693 1:54506417-54506439 CTGTGATGGGGGAGGGTGTGTGG + Intergenic
907717126 1:56936834-56936856 CTGTGAGAGGCCAAGGTGGGTGG - Intronic
908279185 1:62512652-62512674 CTGTGAGAGGCCAAGGTGGGAGG + Intronic
909134492 1:71780856-71780878 CTCAGAAGAGGGAAGGTGGGTGG - Intronic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911457800 1:98148912-98148934 CTCAGAAGGGGAAAGGTGGGAGG + Intergenic
911627492 1:100141573-100141595 CTTTGGAAGGGTAAGGTGGGAGG - Intronic
912039537 1:105370556-105370578 CAGTGAAGGGGGAATGTTGGGGG + Intergenic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
912971566 1:114288686-114288708 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
913166543 1:116192359-116192381 CAGTGAACAGGGTAGGTGAGAGG + Intergenic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
913991862 1:143620499-143620521 TTGGGAACGCTGAAGGTGGGAGG - Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
915388443 1:155518674-155518696 TTGAGAACGGGGGCGGTGGGGGG + Intronic
915523282 1:156460950-156460972 TTGGAAACGGGGAAGGTGGGGGG + Intergenic
915910926 1:159914851-159914873 CTGTGGTCGGGGAAGGGGTGTGG + Intergenic
916776871 1:167975794-167975816 CTGTGAGAGGCCAAGGTGGGAGG - Intronic
916860606 1:168800505-168800527 CTGTGATGGGGCATGGTGGGTGG + Intergenic
917102264 1:171458543-171458565 CTGTGAAAGTCCAAGGTGGGAGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917124071 1:171670521-171670543 CTGGGAACGCCGAAGGTGGGAGG + Intergenic
917478108 1:175386168-175386190 TGGTGGGCGGGGAAGGTGGGAGG - Exonic
919546001 1:198919599-198919621 CTGTTAACTGGTGAGGTGGGTGG - Intergenic
919833111 1:201555849-201555871 CTGTGAAGGGAGATGGGGGGCGG + Intergenic
920703649 1:208236148-208236170 CTGTGGACGGGGAAGGAGCCTGG + Intronic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921155948 1:212438955-212438977 CTGAGAAGGTGGAGGGTGGGTGG - Intronic
921165911 1:212506999-212507021 CTGAGAGTGGGGAAGGTAGGAGG - Intergenic
921448845 1:215278959-215278981 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
922203392 1:223425996-223426018 CTATGGAGCGGGAAGGTGGGTGG - Intergenic
922615254 1:226957289-226957311 GTGTGAACCAGGGAGGTGGGGGG - Intronic
922927952 1:229366146-229366168 CTCAGAACGGGGAGAGTGGGAGG - Intergenic
1063488114 10:6438839-6438861 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
1064384569 10:14878938-14878960 CTGGGAACAGGGAAGGCGAGGGG - Intronic
1064463270 10:15555465-15555487 CTGCGGACAGGGAAGGAGGGAGG + Intronic
1064598129 10:16966690-16966712 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1064642657 10:17430047-17430069 CTCAGAAAGGGGAAGATGGGAGG - Intronic
1064734769 10:18370541-18370563 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1065856959 10:29838848-29838870 GGGTGAAGGGGGAAGGGGGGAGG + Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066118323 10:32259735-32259757 CTTTGAGAGGGCAAGGTGGGAGG - Intergenic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1067899832 10:50228078-50228100 CTCTGAAAGGTCAAGGTGGGAGG + Intronic
1068405619 10:56585144-56585166 CTGAGAAGGGGGAGAGTGGGAGG - Intergenic
1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1070911836 10:80125721-80125743 CTCAGAACGGGGAGGATGGGTGG + Intergenic
1071629224 10:87204403-87204425 GTGGGAGGGGGGAAGGTGGGGGG + Intergenic
1073011007 10:100359577-100359599 GTGTGAACTGGGGAGGAGGGGGG - Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1073557693 10:104468455-104468477 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1074057078 10:109932250-109932272 CTGTGACTGGGGAGGATGGGAGG - Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075077931 10:119363686-119363708 CTGGGAAGAGGGAAGCTGGGAGG + Intronic
1075861186 10:125678537-125678559 CAATGAACGAGGCAGGTGGGTGG + Intronic
1076296716 10:129391533-129391555 GTGAGAACGGGCAGGGTGGGTGG + Intergenic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077274547 11:1697840-1697862 CTGGGAACTGGGAAGGTGTTGGG - Intergenic
1077308793 11:1879491-1879513 CTGTGAGCGGGGCTGGTGGTGGG + Intronic
1077330030 11:1980142-1980164 CTGTCACCAGGCAAGGTGGGGGG - Intronic
1077333659 11:1994155-1994177 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077498393 11:2897648-2897670 CTGAGAAGGTGTAAGGTGGGCGG + Intronic
1078162587 11:8854630-8854652 CTTTGAGAGGGCAAGGTGGGAGG + Intronic
1078331878 11:10429090-10429112 CCATGAAATGGGAAGGTGGGAGG - Intronic
1078997954 11:16723323-16723345 TTGCGGAGGGGGAAGGTGGGAGG + Intronic
1080013052 11:27477400-27477422 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG + Intergenic
1081181895 11:39994115-39994137 CTTTGAAGGGCCAAGGTGGGTGG + Intergenic
1081280983 11:41209035-41209057 ATTTGAAGGGGAAAGGTGGGAGG + Intronic
1082054772 11:47804891-47804913 CTTTGGAAGGGTAAGGTGGGAGG + Intronic
1082243222 11:49892177-49892199 CTGGCAGCGGGGCAGGTGGGAGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083172172 11:60929482-60929504 GGGTGAACTGGGTAGGTGGGTGG - Intronic
1084341726 11:68508371-68508393 CTGTGAGAGGTGGAGGTGGGTGG - Intronic
1084546433 11:69817353-69817375 CTGCGCACTGGGAAGGCGGGAGG - Intronic
1084729720 11:71065441-71065463 CAGTGAGTGGGGAAGTTGGGGGG + Intronic
1084729812 11:71065863-71065885 CGGTGAGTGGGGAAGTTGGGGGG + Intronic
1084729839 11:71065968-71065990 CAGTGAGTGGGGAAGTTGGGAGG + Intronic
1084729880 11:71066128-71066150 CAGTGAGTGGGGAAGTTGGGTGG + Intronic
1084729898 11:71066182-71066204 CAGTGAGTGGGGAAGTTGGGGGG + Intronic
1084729937 11:71066336-71066358 CAGTGAGTGGGGAAGTTGGGGGG + Intronic
1085045039 11:73347773-73347795 CTGACAGCTGGGAAGGTGGGTGG + Intronic
1085311576 11:75520089-75520111 CTGTTCACAGGGAAGGTGGTGGG + Intronic
1086697650 11:89864000-89864022 CTGGCAGCGGGGCAGGTGGGAGG + Intergenic
1086708509 11:89980488-89980510 CTGGCAGCGGGGCAGGTGGGAGG - Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087070022 11:94069362-94069384 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1088871815 11:113896892-113896914 CTGGGAACGGGGTCGGGGGGAGG - Intergenic
1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1089216142 11:116835774-116835796 CTGAGCACCGGGAAGGGGGGCGG + Exonic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089481751 11:118811407-118811429 CTTTGAGCGGCCAAGGTGGGTGG + Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1202813007 11_KI270721v1_random:35321-35343 CTGTCACCAGGCAAGGTGGGGGG - Intergenic
1202816640 11_KI270721v1_random:49337-49359 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092146276 12:6216795-6216817 CTGTGATCGGAGAAGGCGGCTGG - Intronic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092988859 12:13875283-13875305 CTGTGAGAGGCCAAGGTGGGTGG + Intronic
1093832790 12:23784831-23784853 CTTTGAGAGGGTAAGGTGGGAGG + Intronic
1094492988 12:30972798-30972820 CTGCGCAGGGGGGAGGTGGGGGG + Intronic
1094639815 12:32262898-32262920 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1096455398 12:51780909-51780931 CTTTGCACGGGGCAGGTGTGGGG - Intronic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1097231165 12:57512124-57512146 CTGTGCATGGGGAGGGTAGGCGG + Intronic
1098336847 12:69413167-69413189 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
1099537021 12:83857624-83857646 CTGGGAACAGGGAAGTTGGGTGG + Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1101815485 12:108143055-108143077 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1101863494 12:108501809-108501831 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1102169140 12:110828891-110828913 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1103334258 12:120177416-120177438 CTGTCAACCAGGATGGTGGGAGG - Intronic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1103950231 12:124546654-124546676 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1103984712 12:124759600-124759622 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1107786712 13:43964786-43964808 CTGTGAACAGAGAAGCTGTGGGG + Intergenic
1108010702 13:46005848-46005870 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1110222570 13:73089288-73089310 CTTTGGAAGGGCAAGGTGGGAGG - Intergenic
1110855236 13:80289778-80289800 CTTTGAGGGGCGAAGGTGGGAGG + Intergenic
1111299136 13:86323347-86323369 GTGGGGTCGGGGAAGGTGGGGGG + Intergenic
1111593939 13:90387801-90387823 CTGTGAGAGGTCAAGGTGGGAGG + Intergenic
1111987346 13:95078512-95078534 CTTTGCACTGGGAAGGTGGCAGG + Intronic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1113750711 13:112774916-112774938 CCGTGACGGGGGAAGGTGGGAGG - Intronic
1113770615 13:112906004-112906026 CTGAGAACAGGGAAGTTGGACGG - Intronic
1114315371 14:21505057-21505079 CTGTGAGAGGCCAAGGTGGGAGG + Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1115986440 14:39107176-39107198 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1116019013 14:39439492-39439514 CTATGAAAGGCTAAGGTGGGAGG - Intergenic
1116151376 14:41145791-41145813 CTGCCAACTGGGAAGGTGTGGGG + Intergenic
1117059745 14:51949981-51950003 CTCTGAAAGGTCAAGGTGGGAGG - Intronic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1117386660 14:55221069-55221091 CTTTGAAAGGTCAAGGTGGGCGG + Intergenic
1118005797 14:61563316-61563338 ATGTGAACGGGGAAGCCGAGAGG + Intronic
1118884972 14:69859015-69859037 AGGTGAAGGGGGCAGGTGGGAGG + Intronic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121238351 14:92410034-92410056 ATTTGAGGGGGGAAGGTGGGAGG + Intronic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122580897 14:102770990-102771012 ATAAGCACGGGGAAGGTGGGAGG + Intergenic
1123020405 14:105395339-105395361 CTGAGAGTGGGGAAGGTGTGAGG - Exonic
1202835425 14_GL000009v2_random:74546-74568 GAGTGAAAGGTGAAGGTGGGGGG + Intergenic
1202946621 14_KI270726v1_random:33505-33527 CTGAGGACGGGACAGGTGGGCGG + Intergenic
1123971976 15:25515839-25515861 CTGTGAATGGGGAGGGTGATGGG + Intergenic
1125128645 15:36255044-36255066 CAGAGAGTGGGGAAGGTGGGGGG - Intergenic
1127067876 15:55259057-55259079 CTTTGGACGGCCAAGGTGGGCGG - Intronic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127384946 15:58459842-58459864 CTGTGAAGGAGGAAGCTGAGAGG - Intronic
1127441116 15:59009200-59009222 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
1127465650 15:59241975-59241997 CTGTGATGTGGGAAGCTGGGAGG + Intronic
1128061040 15:64736306-64736328 CTGTGAATGGGAGAGCTGGGTGG + Intergenic
1128999257 15:72319461-72319483 CTGTGATCTGGGAAGGGGGCTGG + Intronic
1129854984 15:78817175-78817197 CTTTGAGAGGGTAAGGTGGGAGG + Intronic
1131134834 15:89926345-89926367 CTCTGAGAGGTGAAGGTGGGAGG + Intergenic
1131423377 15:92326086-92326108 CAGTGATGGGGGATGGTGGGTGG + Intergenic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1133742944 16:8665012-8665034 CTGTGAGCGAGAAAGCTGGGTGG + Intergenic
1133924583 16:10182592-10182614 TTGGGAAGGGGGGAGGTGGGAGG - Intronic
1134009984 16:10844716-10844738 CTTTGAAAGGCGGAGGTGGGAGG - Intergenic
1134060058 16:11194027-11194049 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1134291290 16:12904109-12904131 CTGTGGTTGCGGAAGGTGGGCGG - Intronic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1135218557 16:20593557-20593579 CTCAGAAGGAGGAAGGTGGGAGG - Intergenic
1135941928 16:26829312-26829334 CTTTGAAAGGTCAAGGTGGGTGG + Intergenic
1136402019 16:30024374-30024396 CTGGGAAGGGAGGAGGTGGGGGG - Exonic
1136702233 16:32154768-32154790 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1136765434 16:32772717-32772739 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1136802665 16:33097662-33097684 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1138597024 16:58034637-58034659 CAGTGATTGGGGAAGCTGGGGGG - Intronic
1138660718 16:58515603-58515625 CTGCGAACGGAGAAGGGGTGAGG - Intronic
1139340401 16:66264558-66264580 GAGTGAGCGGGGAAGGTGGGGGG - Intergenic
1140213255 16:72987384-72987406 CTTTGATCGGGGAGGGTGGGAGG - Intronic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1140407653 16:74721727-74721749 CTGTGAAGTAGGAAGCTGGGTGG - Intronic
1140450988 16:75070663-75070685 CTGGGAAGGGGTATGGTGGGCGG - Intronic
1140463466 16:75160287-75160309 CTTTGAAGGGCCAAGGTGGGTGG + Intronic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1141054468 16:80803590-80803612 CTGCGAAGGGGGAGGCTGGGTGG - Intronic
1141545399 16:84764319-84764341 TGGTGAAGGGGGAAGGTGTGAGG + Intronic
1141752482 16:85968072-85968094 CTGGGAACGGGGCATGGGGGTGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1203067822 16_KI270728v1_random:1034939-1034961 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1142735684 17:1897552-1897574 TTGTGAGCGGGGATGGGGGGGGG - Exonic
1142791681 17:2271468-2271490 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1143135427 17:4710185-4710207 CTGGGAAGGAGGATGGTGGGGGG - Intergenic
1143173950 17:4945906-4945928 CTGGGAACGCCGAAGGTGGGAGG + Exonic
1143658861 17:8312679-8312701 CTGAAAACGGAGAAGATGGGTGG - Intronic
1144421914 17:15106702-15106724 CTGTGAAGAATGAAGGTGGGTGG - Intergenic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1145230505 17:21170200-21170222 CTGAAAACAGGGAATGTGGGAGG - Intronic
1145781210 17:27564743-27564765 CTGTGGGTGGGGGAGGTGGGGGG - Intronic
1146454548 17:32998704-32998726 CTCTAAAGGAGGAAGGTGGGTGG + Intergenic
1146551057 17:33780754-33780776 CTCTGAGCAGGGAAGGCGGGAGG + Intronic
1146629358 17:34458814-34458836 CTGTGAACCGGGAAGAAAGGAGG - Intergenic
1146937055 17:36818541-36818563 CTGTGAAGGAGGAAAGTAGGCGG - Intergenic
1147001677 17:37367822-37367844 CTGTGAGAGGCCAAGGTGGGTGG + Intronic
1147037378 17:37691865-37691887 CTGACAAGGGGGCAGGTGGGTGG - Intronic
1147257256 17:39189119-39189141 CTTTGAAAGGCTAAGGTGGGTGG + Intronic
1147583240 17:41638491-41638513 CTGGGAAGGTGGAGGGTGGGAGG - Intergenic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148135715 17:45290448-45290470 GTGGGCACGGGGCAGGTGGGTGG - Intronic
1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG + Intronic
1148546373 17:48522282-48522304 CTATGAACCGGGAAGGAAGGGGG + Intergenic
1148680308 17:49469984-49470006 GGGTGGACGGGGCAGGTGGGAGG + Intronic
1149131507 17:53307052-53307074 CTCTGAATGTGGAGGGTGGGAGG + Intergenic
1149467739 17:56893096-56893118 CTGGGATCGGGGAAGCTGGGTGG + Intronic
1151210066 17:72537842-72537864 CTTTGAGAGGGCAAGGTGGGCGG - Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151623194 17:75259904-75259926 CTTTGTAAGGGAAAGGTGGGAGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151979430 17:77499782-77499804 CTCTGAGCTGGGGAGGTGGGAGG + Exonic
1152800335 17:82327948-82327970 CGGTGGACGGGCAGGGTGGGGGG - Intronic
1152892800 17:82892024-82892046 CTGTGCAGGGGGGAAGTGGGGGG - Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1155261001 18:24042398-24042420 CTGTGAACTGTGCACGTGGGGGG - Intronic
1156782134 18:40863225-40863247 CTTTGAGGGGCGAAGGTGGGTGG - Intergenic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1157990247 18:52487118-52487140 CTGTGGACTGGGAGGGTTGGTGG + Intronic
1160579219 18:79874131-79874153 CTGTGATGGGGAAAGGCGGGAGG - Intronic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1160687737 19:444516-444538 TAGTGCACGGGGGAGGTGGGGGG + Intronic
1160717665 19:583687-583709 CTGGGAACTTGGAAGGTGGCTGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG + Intronic
1161416540 19:4150247-4150269 CCCTGAATGGGGAAGGAGGGAGG + Intergenic
1161473260 19:4471978-4472000 AGGTGAAAGGGAAAGGTGGGAGG - Intergenic
1161586485 19:5108469-5108491 CTGGGACTGGGTAAGGTGGGGGG + Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1162099047 19:8328682-8328704 CTGTGAGCCGAGAAGCTGGGAGG + Intronic
1162686210 19:12386573-12386595 CTTTGAATGGCCAAGGTGGGAGG - Intronic
1163229297 19:15989303-15989325 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1163341440 19:16710097-16710119 CTGTGAGCGGGGAAGCAGGCAGG - Intergenic
1163450621 19:17375063-17375085 CTGTGAGAGGCCAAGGTGGGTGG - Intronic
1163468015 19:17480619-17480641 CTTTGAAAGGTCAAGGTGGGAGG - Intronic
1164647293 19:29868686-29868708 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1164847860 19:31449749-31449771 CTGTGAGAGGCCAAGGTGGGTGG + Intergenic
1164973562 19:32552947-32552969 CTTTGAGAGGTGAAGGTGGGAGG + Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165683974 19:37802148-37802170 CTGTGAACTGTGCATGTGGGGGG - Intronic
1166058805 19:40311600-40311622 CTGTGAAAGCGCAAGGTGTGGGG - Intergenic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1167929787 19:52854779-52854801 CTCTGAAAGGCCAAGGTGGGTGG + Intronic
1168245887 19:55113039-55113061 AAGTGAACGGGGAAGGGAGGGGG + Intronic
925404698 2:3598552-3598574 CAGCGAACAAGGAAGGTGGGAGG + Intronic
925587031 2:5474807-5474829 GTGTGAACGTGGCAAGTGGGTGG - Intergenic
926009437 2:9396518-9396540 CTCTGAAAGGCCAAGGTGGGAGG - Intronic
926906945 2:17814834-17814856 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
927469942 2:23366165-23366187 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929752671 2:44732195-44732217 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
929766908 2:44851741-44851763 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
932233991 2:70106503-70106525 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
932723410 2:74157133-74157155 CTGTGATCTGGGAAGGGGAGAGG - Intronic
933019059 2:77167800-77167822 ATGGGATGGGGGAAGGTGGGAGG + Intronic
933395722 2:81728506-81728528 ATGTGAACTTGGGAGGTGGGTGG + Intergenic
933674783 2:85045001-85045023 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
934551743 2:95267093-95267115 CGGTGGACGTGGAAGGTGGGGGG + Intergenic
934554919 2:95282040-95282062 CTGGGACCGGGGAAGGAAGGAGG + Intronic
934673384 2:96231402-96231424 CTGTGAGTGGCCAAGGTGGGAGG - Intergenic
935197981 2:100831640-100831662 CTATGAAGGGGAAAGGGGGGAGG - Intronic
935296630 2:101655451-101655473 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
935838367 2:107079750-107079772 CTATGGACGGGGGAGGTGAGAGG + Intergenic
935881833 2:107573147-107573169 TAGTAGACGGGGAAGGTGGGGGG + Intergenic
936267855 2:111023867-111023889 CTGCGATGGTGGAAGGTGGGTGG + Intronic
936561269 2:113541721-113541743 CTGGCAGCGGAGAAGGTGGGCGG + Intergenic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
938861488 2:135374161-135374183 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
939178660 2:138780406-138780428 CAGGGAAGGGGGAGGGTGGGCGG + Intergenic
939306084 2:140414157-140414179 CTTTGAAAGGTAAAGGTGGGAGG - Intronic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
942715020 2:178882126-178882148 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
942901449 2:181124755-181124777 CTGTGAAGGAGGAAGTAGGGGGG - Intergenic
944294507 2:198047423-198047445 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
944320831 2:198339819-198339841 TTGGGAACTGGGTAGGTGGGGGG + Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
946089307 2:217206826-217206848 CTATGAATGGGGCACGTGGGAGG - Intergenic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946349975 2:219143955-219143977 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
946507847 2:220320737-220320759 ATGGAAACGGGGAAGGAGGGAGG + Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947644067 2:231725201-231725223 CTGTGAACAGAGAAAGTTGGGGG - Intergenic
947737836 2:232466344-232466366 AGGTGAACGGGGAAGGGGAGAGG - Intergenic
947784860 2:232807813-232807835 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
948075779 2:235164171-235164193 TTCTCAAGGGGGAAGGTGGGGGG + Intergenic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169338540 20:4777313-4777335 TTTTGAAAGGGTAAGGTGGGTGG - Intergenic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1171844851 20:30261377-30261399 CTTTGAGAGGGCAAGGTGGGTGG - Intergenic
1172033147 20:31995544-31995566 CTGGCAACGGGGAAGGGAGGAGG - Intronic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172397413 20:34618536-34618558 CTTTGAAAGGCAAAGGTGGGAGG + Intronic
1172726467 20:37046854-37046876 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1172948616 20:38707308-38707330 CTTTGAAAGGCCAAGGTGGGCGG - Intergenic
1173299503 20:41789215-41789237 CTGTCAACAGGGAAAGTGGGGGG + Intergenic
1173526737 20:43738525-43738547 CTTTGGAAGGGTAAGGTGGGTGG + Intergenic
1173899489 20:46576708-46576730 CTGTGACCAGGGAAGCAGGGAGG + Intronic
1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG + Intronic
1176182656 20:63758185-63758207 CTCTGGACGGGGCGGGTGGGGGG - Intronic
1176448196 21:6840167-6840189 CTGTTCACGGGGAAGCCGGGCGG + Intergenic
1176826366 21:13705189-13705211 CTGTTCACGGGGAAGCCGGGCGG + Intergenic
1176938557 21:14896296-14896318 CTGAGTACAGGGAAGGTGTGAGG - Intergenic
1177169813 21:17642584-17642606 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1178576638 21:33798341-33798363 CTCTGAAAGGCCAAGGTGGGAGG - Intronic
1179098263 21:38334933-38334955 CTGTGAAGGAGGAATGGGGGTGG - Intergenic
1180636957 22:17269240-17269262 CTAGGAAAGGTGAAGGTGGGGGG + Intergenic
1181063450 22:20293253-20293275 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1181165222 22:20979604-20979626 CTGTGGGCCGGGCAGGTGGGTGG - Intronic
1182047422 22:27286269-27286291 CAGTGAACGGGGATTGTGGTAGG - Intergenic
1182520666 22:30882832-30882854 CTGTGAACAGCAAAGGTAGGAGG + Intronic
1182939290 22:34259431-34259453 CTGATACCTGGGAAGGTGGGTGG - Intergenic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1183449336 22:37883051-37883073 CTTTGAGAGGCGAAGGTGGGCGG + Intronic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184480048 22:44741061-44741083 CTTTGAGAGGGCAAGGTGGGTGG + Intronic
1185046193 22:48529772-48529794 GTGTGGACGGGGAGGGTGTGTGG + Intronic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
949490499 3:4584469-4584491 GTGGGAACGGGGAAGCGGGGAGG + Intronic
949543849 3:5055280-5055302 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
950520115 3:13493160-13493182 CTGTGGGTGGGGCAGGTGGGGGG - Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
951348446 3:21575264-21575286 CTGTGCAGGGTGGAGGTGGGAGG + Intronic
951888428 3:27547049-27547071 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
952304092 3:32130130-32130152 CTGCGAACAGGGAGAGTGGGAGG + Intronic
952318040 3:32248889-32248911 CTGTGAGAGGCCAAGGTGGGAGG - Intronic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
953195400 3:40727511-40727533 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
953637604 3:44676211-44676233 CTCTGACCGGGGAAGTTGGCTGG - Intergenic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954288373 3:49635729-49635751 CTTTGAGAGGCGAAGGTGGGAGG + Intronic
954347048 3:50008792-50008814 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
956211767 3:66808998-66809020 CTGTGAACAGGGAAGGAGAGCGG - Intergenic
956539621 3:70321249-70321271 CTGGGAATGGGGATGGAGGGAGG - Intergenic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
959943255 3:112101798-112101820 CTGAGAAAGGCGTAGGTGGGAGG - Intronic
960614397 3:119583666-119583688 CTGTGAAAGGCCAAGGTGAGAGG + Intronic
960959694 3:123061519-123061541 CTCTGAACAGGGAAGGTGAAAGG - Intergenic
962063500 3:131954638-131954660 ATGGGATGGGGGAAGGTGGGAGG - Intronic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
962767800 3:138581458-138581480 CTTTGAGAGGTGAAGGTGGGTGG + Intronic
962778482 3:138687696-138687718 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
962922198 3:139960327-139960349 CTCTGAAAGGGAAATGTGGGGGG - Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
964234364 3:154507529-154507551 CTTTGAGAGGTGAAGGTGGGAGG - Intergenic
964318327 3:155467328-155467350 CTTTGGACGGCTAAGGTGGGTGG + Intronic
964683724 3:159370810-159370832 CTGAAAACTGGGGAGGTGGGAGG - Intronic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
965608898 3:170524399-170524421 CTGTGATGGGGGTAGGTGGCAGG + Intronic
965826932 3:172741033-172741055 TTGTGAACGAGGTTGGTGGGGGG + Intergenic
967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG + Intergenic
968152455 3:196347854-196347876 CTTGAAACGGGGAGGGTGGGGGG - Exonic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
972287315 4:37661521-37661543 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG + Intronic
973563978 4:52165348-52165370 GTGTGAGGGGGGAGGGTGGGGGG - Intergenic
973778526 4:54266488-54266510 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975157815 4:71091189-71091211 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
975531115 4:75400317-75400339 CTGAGAACAGGGAAAGTGGTGGG - Intergenic
976144737 4:82031529-82031551 GTGTGACTGGGGAAGATGGGGGG - Intronic
976934772 4:90616435-90616457 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
977707633 4:100088991-100089013 CTCAGAACGGGAAGGGTGGGAGG - Intergenic
977767878 4:100822369-100822391 CTTTGAAGGGCCAAGGTGGGCGG + Intronic
978913683 4:114097074-114097096 CTCAGAATGGGGAAGGTGGAAGG - Intergenic
980030463 4:127823390-127823412 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
980963803 4:139501426-139501448 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG + Intronic
982436747 4:155389019-155389041 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
982683086 4:158456216-158456238 ACTTGAAGGGGGAAGGTGGGAGG + Intronic
985237323 4:187890328-187890350 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
1202764518 4_GL000008v2_random:138660-138682 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
985812768 5:2102346-2102368 CTGTGAAAGGCCAAGGTGGCTGG - Intergenic
986608548 5:9545926-9545948 CCCTGCACGGGGAAGGTGGAGGG + Exonic
986687501 5:10287481-10287503 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
988458629 5:31411868-31411890 CTTTGAAAGGTCAAGGTGGGTGG - Intronic
988719068 5:33858411-33858433 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
988924562 5:35976594-35976616 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
990042432 5:51390122-51390144 CTGAGGGCGGGGAAGCTGGGAGG + Intronic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992181994 5:74206596-74206618 CTGTGAACAGAGGAGGAGGGAGG - Intergenic
992564046 5:77980585-77980607 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
993633645 5:90317943-90317965 CTGTCACTGGGGAAGGGGGGTGG + Intergenic
993654864 5:90564989-90565011 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
995667355 5:114557661-114557683 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997333863 5:133089768-133089790 CTTTGAAAGGCTAAGGTGGGAGG + Intronic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
1000070928 5:157740508-157740530 CTCTGAAGGGGGAAGGTAGTGGG + Exonic
1001293890 5:170485426-170485448 GTGTGGACGGGGAGGGTGGCTGG + Intronic
1001485165 5:172114862-172114884 CAGTGAAGGCCGAAGGTGGGGGG - Intronic
1002289059 5:178187367-178187389 CTGTGCTCGGGGAAGGCTGGCGG - Intergenic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1004170674 6:13293330-13293352 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
1004300356 6:14452152-14452174 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1004300890 6:14456122-14456144 CTGTGGTGGGGGGAGGTGGGGGG - Intergenic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1006836157 6:36999947-36999969 CTCAGATGGGGGAAGGTGGGAGG - Intergenic
1006836417 6:37001675-37001697 CTCAGATGGGGGAAGGTGGGAGG + Intergenic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1009934191 6:70214044-70214066 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1010232443 6:73546811-73546833 CTTTGAAGGGCCAAGGTGGGTGG + Intergenic
1012609191 6:101194445-101194467 ATGTGGTCGGGGAAGGGGGGAGG + Intergenic
1012847329 6:104407341-104407363 CTTTGAGCGGCCAAGGTGGGAGG + Intergenic
1012959790 6:105610182-105610204 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013094844 6:106935270-106935292 CTTTGAAAGGTGGAGGTGGGAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014028407 6:116674465-116674487 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1015017745 6:128434774-128434796 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015480246 6:133700638-133700660 CTGGGATTGGGGAGGGTGGGAGG - Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1016233205 6:141831114-141831136 CTGTGCACTGGGAGGATGGGAGG - Intergenic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017399109 6:154039317-154039339 CTGTGAACTACTAAGGTGGGAGG + Intronic
1018349762 6:162943958-162943980 CTGTGGGCTGGGCAGGTGGGTGG - Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1018891515 6:167986274-167986296 ATGTGAGCGTGGACGGTGGGAGG + Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1020237262 7:6366020-6366042 CTTTGAAAGGGCGAGGTGGGTGG + Intergenic
1020579406 7:9976068-9976090 CTGTGAAAGGCCAAGGTGAGCGG - Intergenic
1021873128 7:25023187-25023209 CTCTGAAGGGGGAGGGTTGGGGG - Intergenic
1023393950 7:39734996-39735018 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1024619875 7:51148212-51148234 TTGTGCACAGGGCAGGTGGGAGG + Intronic
1025934250 7:66021952-66021974 CTTTGAAAGGCTAAGGTGGGTGG + Intergenic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026978659 7:74514088-74514110 CTGTGAAAGGGGAGGACGGGTGG + Intronic
1027053150 7:75032215-75032237 CTGGGAGTGGGGACGGTGGGGGG + Intronic
1027241557 7:76333344-76333366 CTCTGAGCGGCCAAGGTGGGAGG - Intronic
1028399393 7:90408257-90408279 CTTTGAAAGGTGGAGGTGGGGGG + Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029878788 7:103783236-103783258 CTTTGAGAGGGCAAGGTGGGAGG - Intronic
1030912590 7:115270363-115270385 CTTTGAGAGGGTAAGGTGGGAGG - Intergenic
1031552685 7:123134134-123134156 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1033454967 7:141494658-141494680 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1034095902 7:148407458-148407480 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034186624 7:149182887-149182909 CTATTAGCGGGGAAGGTGTGGGG + Intergenic
1034616202 7:152418948-152418970 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034657739 7:152742763-152742785 AGGGGAGCGGGGAAGGTGGGAGG + Intergenic
1034690590 7:153010555-153010577 CTGGGAACGGGAATGGTGAGCGG + Intergenic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1035086173 7:156260295-156260317 CAGTGAGCGGGGAATGGGGGTGG - Intergenic
1036992796 8:13617882-13617904 TTGTGAGCAGGGAAGGAGGGAGG + Intergenic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1038843319 8:31206061-31206083 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1039639006 8:39198619-39198641 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1040661588 8:49582272-49582294 CTTTGGGCGGGGAAGGTTGGTGG - Intergenic
1040719856 8:50306044-50306066 CTCAGAAGGGGGAGGGTGGGAGG - Intronic
1040954638 8:52967389-52967411 ATGTGAAGGTGGAGGGTGGGAGG - Intergenic
1041439037 8:57874263-57874285 CTGTAATTGGTGAAGGTGGGAGG - Intergenic
1041710069 8:60886391-60886413 CTGTGAATAGGGATGGTTGGAGG - Intergenic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1044116560 8:88343169-88343191 CTGTCAAGGGGGGTGGTGGGGGG - Intergenic
1044962585 8:97545379-97545401 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1045709548 8:104966998-104967020 GTGTGAGTGGGGAAAGTGGGAGG - Intronic
1046555673 8:115769391-115769413 CTGTAAATGCGGAAGGTGTGAGG + Intronic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1046973416 8:120247683-120247705 CTTTCACCGGGGAAGATGGGGGG - Exonic
1046985683 8:120385794-120385816 CTCAGAAGGGTGAAGGTGGGAGG - Intronic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1048348314 8:133595286-133595308 CTGTGAAGGTGGGAGGAGGGAGG + Intergenic
1048447344 8:134501663-134501685 CTTTGAAGGGGAAAGGTGAGTGG + Intronic
1049120374 8:140731649-140731671 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049716469 8:144095335-144095357 CTGGGACCGGGGACGCTGGGTGG - Intronic
1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG + Intergenic
1049891423 9:73618-73640 CTGGCAGCGGAGAAGGTGGGCGG - Intergenic
1050195409 9:3078030-3078052 CTCAAAACGGGGAAGGTGGAAGG - Intergenic
1050387952 9:5110825-5110847 GTTTGTTCGGGGAAGGTGGGGGG + Intronic
1051015304 9:12467598-12467620 CTGTGAATGTAGAAGTTGGGGGG + Intergenic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1052029691 9:23614356-23614378 CTTTGAAAGGCCAAGGTGGGGGG + Intergenic
1052666097 9:31496981-31497003 CTGTGATGGGGCAGGGTGGGGGG + Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1052749598 9:32476250-32476272 CTTTGAGAGGGCAAGGTGGGAGG + Intronic
1053008843 9:34622176-34622198 CTGTCTACGGGGATGGAGGGGGG - Intronic
1053732845 9:41074692-41074714 CTGGCAGCGGAGAAGGTGGGCGG - Intergenic
1054695584 9:68356862-68356884 CTGGCAGCGGAGAAGGTGGGTGG + Intronic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055668408 9:78575147-78575169 CTGTGAACTGGGGTGTTGGGGGG + Intergenic
1055758602 9:79582121-79582143 TTTTGAAGGGGGAAGCTGGGAGG + Intronic
1056812021 9:89772308-89772330 GTGGGAGCGGGGAAGGTGGTGGG + Intergenic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058585749 9:106504594-106504616 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1059419576 9:114182779-114182801 CTGTTAACCTGGAAGGTAGGTGG - Intronic
1059470019 9:114497872-114497894 CTGGGAAGGAGGCAGGTGGGAGG + Intronic
1060487780 9:124060240-124060262 CTTTGGATGGCGAAGGTGGGAGG + Intergenic
1203520995 Un_GL000213v1:44351-44373 CTGTTCACGGGGAAGCCGGGCGG - Intergenic
1203545267 Un_KI270743v1:123547-123569 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
1186541523 X:10405885-10405907 CTGGGGTCGGGGAAGGGGGGAGG + Intergenic
1186816209 X:13240470-13240492 CTGGGAACTGGGCAGGTAGGAGG - Intergenic
1187128348 X:16475686-16475708 CTGTGGAGGGGGAAGTTAGGAGG + Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1189002240 X:36958765-36958787 CTTTGAACTGGGGAGATGGGAGG - Intergenic
1189307713 X:39999525-39999547 CTTTGAAAGGTTAAGGTGGGAGG + Intergenic
1189573931 X:42329733-42329755 CTCAGAGCGTGGAAGGTGGGAGG + Intergenic
1190101531 X:47526012-47526034 CTGGGAGCAGGGGAGGTGGGTGG + Intergenic
1190116269 X:47627820-47627842 CTGTGCACGGTGAGGGTGAGAGG - Intronic
1190399204 X:50014722-50014744 CTATGACAGGGGAGGGTGGGAGG - Intronic
1190534417 X:51411520-51411542 CTGTGAACTGGGAAAGAGGTGGG + Intergenic
1190598458 X:52067898-52067920 CTGTGAATGGGGGAGGGAGGAGG - Intronic
1190610366 X:52186175-52186197 CTGTGAATGGGGGAGGGAGGAGG + Intronic
1190809676 X:53871096-53871118 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1190908243 X:54749326-54749348 CTGTGAGCGTGGAGGGTTGGGGG + Exonic
1192375848 X:70560990-70561012 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1192415976 X:70981151-70981173 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1192425119 X:71068323-71068345 CTGGGACCGGGGAAAGGGGGTGG + Intronic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194089906 X:89572924-89572946 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1195263714 X:103159887-103159909 CTTTGAGCGGTCAAGGTGGGAGG + Intergenic
1195670687 X:107467367-107467389 CTGTGAACGTGGTCAGTGGGGGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196097739 X:111817648-111817670 CTGTGAACTGTGAAGTTGGCAGG + Intronic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196937987 X:120748685-120748707 CTCTGAAGGGGGAGGCTGGGAGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198374339 X:136023052-136023074 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1198676446 X:139136347-139136369 CTCAGAACGGGGAGGGTGGGGGG - Intronic
1200215325 X:154365702-154365724 CTTGGAAGGGGGAGGGTGGGGGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200442557 Y:3228978-3229000 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1201539171 Y:15087805-15087827 CTGTGGTGGGGGGAGGTGGGAGG - Intergenic
1201684925 Y:16690446-16690468 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic