ID: 1153820536

View in Genome Browser
Species Human (GRCh38)
Location 18:8827838-8827860
Sequence CCGTTTTCATGCCATAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153820536_1153820538 -4 Left 1153820536 18:8827838-8827860 CCAGCATTATGGCATGAAAACGG 0: 1
1: 0
2: 2
3: 4
4: 73
Right 1153820538 18:8827857-8827879 ACGGTTTTATCAGTACAAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153820536 Original CRISPR CCGTTTTCATGCCATAATGC TGG (reversed) Intronic
913581311 1:120229890-120229912 TCGTTTTCATGGCAGAGTGCAGG - Intergenic
913626866 1:120668510-120668532 TCGTTTTCATGGCAGAGTGCAGG + Intergenic
917584175 1:176408608-176408630 CAGTTTCCAGGCCATAGTGCAGG - Intergenic
1063523011 10:6758033-6758055 CTGTTTTCATGCCCAAATGCTGG - Intergenic
1065211038 10:23403258-23403280 CTGTTTTAATTCCATAAGGCTGG + Intergenic
1066280151 10:33909262-33909284 CGGTTTCCAGGCCATGATGCAGG - Intergenic
1068868159 10:61916661-61916683 CTGTTTTAATTCCAAAATGCAGG + Intronic
1080125802 11:28732413-28732435 ACGCTTTCCAGCCATAATGCTGG + Intergenic
1086585266 11:88444169-88444191 TAGTTTTCATGCCATTATACAGG + Intergenic
1088862027 11:113809551-113809573 CCTTTTTCATTACATGATGCTGG - Intronic
1088994691 11:114986280-114986302 CTGGGTTCATGCCACAATGCTGG - Intergenic
1094165963 12:27444121-27444143 CTGTTTTTATGCCAATATGCTGG - Intergenic
1094844427 12:34355202-34355224 CTGTTTTCCTGCCAAAATACAGG + Intergenic
1095963004 12:47847107-47847129 CCATATTCATGCCTCAATGCTGG - Intronic
1102964084 12:117112848-117112870 GCCTTTTCATACCAGAATGCTGG - Intergenic
1105411725 13:20176982-20177004 CTGTTTTCAGGCCACAAGGCCGG + Intergenic
1121442455 14:93957566-93957588 CTGTTTTCATGCCACCTTGCAGG - Intronic
1134341144 16:13347488-13347510 CCTTTTTCAGGGCATAGTGCAGG + Intergenic
1137860152 16:51838733-51838755 CCATTTTTATTCCATATTGCTGG + Intergenic
1139086383 16:63591670-63591692 CAGTTTTCTTGCCATTATTCAGG - Intergenic
1140531399 16:75669830-75669852 CCGTTTTCAAGCCACAATAGCGG + Intronic
1150458395 17:65326857-65326879 GCATTTTCTTGCCAAAATGCAGG + Intergenic
1151736276 17:75942564-75942586 TCATTTTCATGAAATAATGCAGG - Exonic
1153820536 18:8827838-8827860 CCGTTTTCATGCCATAATGCTGG - Intronic
1157236408 18:45968660-45968682 CATTTTTCATGCCATATTGCTGG - Intergenic
1159605862 18:70474162-70474184 CCGTGTGCATCCCAGAATGCAGG - Intergenic
1160044458 18:75373648-75373670 CACATTTCATGCCACAATGCTGG - Intergenic
1161439210 19:4280836-4280858 CCCTTTTCAATGCATAATGCTGG + Intronic
927259483 2:21072648-21072670 CAGAGTTCAGGCCATAATGCTGG + Intergenic
931222460 2:60300210-60300232 CCATTTTCTTGGCATACTGCAGG + Intergenic
948389598 2:237602530-237602552 CCTTTTTCCTGCCACAAGGCAGG + Intergenic
1170760400 20:19244129-19244151 CCATTGTCAAGCCATAATCCAGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177607738 21:23403247-23403269 CCTTTTTCCTGCCAAAATCCAGG - Intergenic
1179825744 21:43965280-43965302 CTGTTCTCATTCCTTAATGCTGG + Intronic
957229182 3:77489755-77489777 AAGTTTTCATGACATTATGCTGG - Intronic
963318860 3:143790517-143790539 CCCATTTCATGCAATACTGCAGG + Intronic
970368849 4:15388051-15388073 CCTTTTACATTGCATAATGCTGG - Intronic
971697227 4:29921961-29921983 CCGTCTTCTTGCCATCTTGCAGG - Intergenic
972694389 4:41430933-41430955 CCGTCATGAAGCCATAATGCTGG - Intronic
980242791 4:130200152-130200174 CAGTTTCCATGGCATAATCCAGG + Intergenic
980656764 4:135797973-135797995 CCGTTTTCATGTCTTAAAGTTGG - Intergenic
986886677 5:12246313-12246335 CCGTTCCCTTGCCATTATGCTGG - Intergenic
987029820 5:13965320-13965342 CAGTTTACATGCAATAATTCAGG - Intergenic
992360040 5:76028133-76028155 CAGTTTCCAAGCCATGATGCGGG - Intergenic
992781998 5:80136333-80136355 CCTTTTTCCTGCCCTTATGCTGG - Intronic
998902714 5:146873141-146873163 CCATTTTCATGGCAAAATTCTGG + Intronic
1000900101 5:166902410-166902432 CCATTTTCATGCCACAATTATGG - Intergenic
1013827350 6:114230267-114230289 CCTTTTTCCTGCTATAATACTGG - Intronic
1016745122 6:147571110-147571132 AGGTTTTCAAGCCACAATGCTGG - Intronic
1019049355 6:169171183-169171205 GCGTTTCCAGGCCAGAATGCGGG + Intergenic
1019256878 7:58019-58041 CCGTTTTCCTGCCATGATGCTGG - Intergenic
1021037411 7:15817088-15817110 CCGTTTTCAAACCATACTGCAGG - Intergenic
1022100228 7:27165055-27165077 CAGGTTTAATGCCATAAGGCCGG + Exonic
1023673215 7:42601977-42601999 GAGTTTCCAGGCCATAATGCAGG + Intergenic
1030798306 7:113816881-113816903 CCTTTTTAAAGCCACAATGCTGG - Intergenic
1031409915 7:121429262-121429284 CTGTTTTCTTGCCATACTGATGG - Intergenic
1035482240 7:159196829-159196851 CAGTTTGCATGCCATGGTGCTGG + Intergenic
1039723397 8:40189081-40189103 CCGTTTTCAAGCCTTAGTGTAGG + Intergenic
1040854728 8:51936977-51936999 CCGGTTTCATGGTAAAATGCAGG + Intergenic
1041981529 8:63866681-63866703 CTGTTTTCATGCCATATTGCTGG + Intergenic
1043501303 8:80860062-80860084 CTGTTTTCATCCCATGCTGCTGG + Intronic
1045977434 8:108145854-108145876 CTCTCTTCTTGCCATAATGCTGG - Intergenic
1048170953 8:132105726-132105748 CAGTTTTCCTGCAATAATGCAGG - Intronic
1051557018 9:18395171-18395193 GCTTTTCCATGACATAATGCTGG - Intergenic
1053614622 9:39750670-39750692 CTGTTTTCTGGCCAGAATGCTGG - Intergenic
1053872649 9:42508604-42508626 CTGTTTTCTGGCCAGAATGCTGG - Intergenic
1053900101 9:42787309-42787331 CTGTTTTCTGGCCAGAATGCTGG + Intergenic
1054238897 9:62591722-62591744 CTGTTTTCTGGCCAGAATGCTGG + Intergenic
1054261539 9:62870287-62870309 CTGTTTTCTGGCCAGAATGCTGG - Intergenic
1054269679 9:62958148-62958170 CTGTTTTCTGGCCAGAATGCTGG + Intergenic
1054553026 9:66626244-66626266 CTGTTTTCTGGCCAGAATGCTGG + Intergenic
1055200908 9:73660758-73660780 CAGTTTTCCTGCCATGGTGCTGG + Intergenic
1057800102 9:98185770-98185792 CCGTTATGATGCCATTTTGCAGG + Intronic
1058527091 9:105869983-105870005 AAGTTTTCATGGCATATTGCTGG - Intergenic
1186847572 X:13545662-13545684 CTGTTTTCATGCAATATTGTTGG - Intergenic
1188946517 X:36311412-36311434 CCTTTTTTATGCCATATTGAGGG + Intronic
1194311777 X:92318905-92318927 ACTTTTTCATGTTATAATGCTGG - Intronic
1199341042 X:146677579-146677601 CAGTTTTCATGCCAACATACCGG + Intergenic
1200620047 Y:5433032-5433054 ACTTTTTCATGTTATAATGCCGG - Intronic