ID: 1153828766

View in Genome Browser
Species Human (GRCh38)
Location 18:8901052-8901074
Sequence AAATACCATCAGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153828766_1153828778 23 Left 1153828766 18:8901052-8901074 CCCTGCCCCATCTGATGGTATTT No data
Right 1153828778 18:8901098-8901120 TCATAAAAAAATAAACTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153828766 Original CRISPR AAATACCATCAGATGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr