ID: 1153828959

View in Genome Browser
Species Human (GRCh38)
Location 18:8902952-8902974
Sequence ACACATATACTTAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153828953_1153828959 26 Left 1153828953 18:8902903-8902925 CCAACCAAGTATCTACTGTCTTC 0: 13
1: 144
2: 310
3: 411
4: 476
Right 1153828959 18:8902952-8902974 ACACATATACTTAAGGTAAAGGG No data
1153828956_1153828959 -7 Left 1153828956 18:8902936-8902958 CCTAATGCATAAGGAGACACATA No data
Right 1153828959 18:8902952-8902974 ACACATATACTTAAGGTAAAGGG No data
1153828952_1153828959 29 Left 1153828952 18:8902900-8902922 CCACCAACCAAGTATCTACTGTC 0: 6
1: 46
2: 71
3: 81
4: 149
Right 1153828959 18:8902952-8902974 ACACATATACTTAAGGTAAAGGG No data
1153828954_1153828959 22 Left 1153828954 18:8902907-8902929 CCAAGTATCTACTGTCTTCAAGA 0: 14
1: 163
2: 319
3: 537
4: 1202
Right 1153828959 18:8902952-8902974 ACACATATACTTAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153828959 Original CRISPR ACACATATACTTAAGGTAAA GGG Intergenic
No off target data available for this crispr