ID: 1153831855

View in Genome Browser
Species Human (GRCh38)
Location 18:8930737-8930759
Sequence AGCTCAGGTATATCACCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153831843_1153831855 26 Left 1153831843 18:8930688-8930710 CCTATTGTCCTGGGGGGTCTCCT No data
Right 1153831855 18:8930737-8930759 AGCTCAGGTATATCACCCACAGG No data
1153831847_1153831855 18 Left 1153831847 18:8930696-8930718 CCTGGGGGGTCTCCTGGGGTAGG No data
Right 1153831855 18:8930737-8930759 AGCTCAGGTATATCACCCACAGG No data
1153831851_1153831855 6 Left 1153831851 18:8930708-8930730 CCTGGGGTAGGAACGGCTGGAGA No data
Right 1153831855 18:8930737-8930759 AGCTCAGGTATATCACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153831855 Original CRISPR AGCTCAGGTATATCACCCAC AGG Intergenic
No off target data available for this crispr