ID: 1153832003

View in Genome Browser
Species Human (GRCh38)
Location 18:8932084-8932106
Sequence CAAACTGATTTTCCCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153831999_1153832003 30 Left 1153831999 18:8932031-8932053 CCAAAGAGCAAATTTATGGATCA No data
Right 1153832003 18:8932084-8932106 CAAACTGATTTTCCCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153832003 Original CRISPR CAAACTGATTTTCCCACAGT GGG Intergenic
No off target data available for this crispr