ID: 1153835728

View in Genome Browser
Species Human (GRCh38)
Location 18:8962407-8962429
Sequence TAGGATCCTAAATATGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153835728_1153835742 25 Left 1153835728 18:8962407-8962429 CCTGTCCCATATTTAGGATCCTA No data
Right 1153835742 18:8962455-8962477 TTTGCGTAACAGACCTGCCTTGG No data
1153835728_1153835734 -6 Left 1153835728 18:8962407-8962429 CCTGTCCCATATTTAGGATCCTA No data
Right 1153835734 18:8962424-8962446 ATCCTAGGTTTTCCCCACAGGGG No data
1153835728_1153835733 -7 Left 1153835728 18:8962407-8962429 CCTGTCCCATATTTAGGATCCTA No data
Right 1153835733 18:8962423-8962445 GATCCTAGGTTTTCCCCACAGGG No data
1153835728_1153835732 -8 Left 1153835728 18:8962407-8962429 CCTGTCCCATATTTAGGATCCTA No data
Right 1153835732 18:8962422-8962444 GGATCCTAGGTTTTCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153835728 Original CRISPR TAGGATCCTAAATATGGGAC AGG (reversed) Intergenic
No off target data available for this crispr