ID: 1153836671

View in Genome Browser
Species Human (GRCh38)
Location 18:8969973-8969995
Sequence AGGAATGAGGAGAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153836671_1153836681 14 Left 1153836671 18:8969973-8969995 CCAACCTCCTTCTCCTCATTCCT No data
Right 1153836681 18:8970010-8970032 TTCCAGCCAAGGAAATTGCTGGG No data
1153836671_1153836676 3 Left 1153836671 18:8969973-8969995 CCAACCTCCTTCTCCTCATTCCT No data
Right 1153836676 18:8969999-8970021 TTCCCTCCTTGTTCCAGCCAAGG No data
1153836671_1153836683 19 Left 1153836671 18:8969973-8969995 CCAACCTCCTTCTCCTCATTCCT No data
Right 1153836683 18:8970015-8970037 GCCAAGGAAATTGCTGGGTGAGG No data
1153836671_1153836680 13 Left 1153836671 18:8969973-8969995 CCAACCTCCTTCTCCTCATTCCT No data
Right 1153836680 18:8970009-8970031 GTTCCAGCCAAGGAAATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153836671 Original CRISPR AGGAATGAGGAGAAGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr