ID: 1153837498

View in Genome Browser
Species Human (GRCh38)
Location 18:8977094-8977116
Sequence TTGGCCACACCCGGCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153837498_1153837504 5 Left 1153837498 18:8977094-8977116 CCAAGGTGGCCGGGTGTGGCCAA No data
Right 1153837504 18:8977122-8977144 TGGTTTTACACATTTTAGGGAGG 0: 24
1: 151
2: 285
3: 242
4: 331
1153837498_1153837502 1 Left 1153837498 18:8977094-8977116 CCAAGGTGGCCGGGTGTGGCCAA No data
Right 1153837502 18:8977118-8977140 TGCTTGGTTTTACACATTTTAGG No data
1153837498_1153837503 2 Left 1153837498 18:8977094-8977116 CCAAGGTGGCCGGGTGTGGCCAA No data
Right 1153837503 18:8977119-8977141 GCTTGGTTTTACACATTTTAGGG 0: 82
1: 758
2: 1344
3: 1177
4: 953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153837498 Original CRISPR TTGGCCACACCCGGCCACCT TGG (reversed) Intergenic
No off target data available for this crispr