ID: 1153837503

View in Genome Browser
Species Human (GRCh38)
Location 18:8977119-8977141
Sequence GCTTGGTTTTACACATTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4314
Summary {0: 82, 1: 758, 2: 1344, 3: 1177, 4: 953}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153837500_1153837503 -7 Left 1153837500 18:8977103-8977125 CCGGGTGTGGCCAACTGCTTGGT No data
Right 1153837503 18:8977119-8977141 GCTTGGTTTTACACATTTTAGGG 0: 82
1: 758
2: 1344
3: 1177
4: 953
1153837492_1153837503 17 Left 1153837492 18:8977079-8977101 CCTGAGAACATGTGCCCAAGGTG 0: 395
1: 746
2: 1123
3: 1025
4: 943
Right 1153837503 18:8977119-8977141 GCTTGGTTTTACACATTTTAGGG 0: 82
1: 758
2: 1344
3: 1177
4: 953
1153837498_1153837503 2 Left 1153837498 18:8977094-8977116 CCAAGGTGGCCGGGTGTGGCCAA No data
Right 1153837503 18:8977119-8977141 GCTTGGTTTTACACATTTTAGGG 0: 82
1: 758
2: 1344
3: 1177
4: 953
1153837490_1153837503 28 Left 1153837490 18:8977068-8977090 CCTCAGGAGATCCTGAGAACATG 0: 161
1: 614
2: 763
3: 1062
4: 1140
Right 1153837503 18:8977119-8977141 GCTTGGTTTTACACATTTTAGGG 0: 82
1: 758
2: 1344
3: 1177
4: 953
1153837497_1153837503 3 Left 1153837497 18:8977093-8977115 CCCAAGGTGGCCGGGTGTGGCCA No data
Right 1153837503 18:8977119-8977141 GCTTGGTTTTACACATTTTAGGG 0: 82
1: 758
2: 1344
3: 1177
4: 953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153837503 Original CRISPR GCTTGGTTTTACACATTTTA GGG Intergenic
Too many off-targets to display for this crispr