ID: 1153837504

View in Genome Browser
Species Human (GRCh38)
Location 18:8977122-8977144
Sequence TGGTTTTACACATTTTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1033
Summary {0: 24, 1: 151, 2: 285, 3: 242, 4: 331}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153837498_1153837504 5 Left 1153837498 18:8977094-8977116 CCAAGGTGGCCGGGTGTGGCCAA No data
Right 1153837504 18:8977122-8977144 TGGTTTTACACATTTTAGGGAGG 0: 24
1: 151
2: 285
3: 242
4: 331
1153837497_1153837504 6 Left 1153837497 18:8977093-8977115 CCCAAGGTGGCCGGGTGTGGCCA No data
Right 1153837504 18:8977122-8977144 TGGTTTTACACATTTTAGGGAGG 0: 24
1: 151
2: 285
3: 242
4: 331
1153837492_1153837504 20 Left 1153837492 18:8977079-8977101 CCTGAGAACATGTGCCCAAGGTG 0: 395
1: 746
2: 1123
3: 1025
4: 943
Right 1153837504 18:8977122-8977144 TGGTTTTACACATTTTAGGGAGG 0: 24
1: 151
2: 285
3: 242
4: 331
1153837500_1153837504 -4 Left 1153837500 18:8977103-8977125 CCGGGTGTGGCCAACTGCTTGGT No data
Right 1153837504 18:8977122-8977144 TGGTTTTACACATTTTAGGGAGG 0: 24
1: 151
2: 285
3: 242
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153837504 Original CRISPR TGGTTTTACACATTTTAGGG AGG Intergenic
900033602 1:388998-389020 TGGTTTTATGCATTTTAGAAAGG - Intergenic
900054437 1:618888-618910 TGGTTTTATGCATTTTAGAAAGG - Intergenic
900727007 1:4223132-4223154 TGGTTTTATATATTTTAGGGAGG + Intergenic
901261980 1:7878576-7878598 TGGCTCTATACATTTTAGGTAGG - Intergenic
901411186 1:9085271-9085293 TGCTTTTCTACATTTTAAGGAGG + Intronic
902103781 1:14016121-14016143 TGGTTCTGCACATCTCAGGGTGG + Intergenic
903392535 1:22974708-22974730 TGATTTTATACATTTTAGGGAGG - Intergenic
903394362 1:22988246-22988268 TGGGTTTATACATTTTAGGGAGG - Intergenic
904088507 1:27928128-27928150 TGGTTTTATACACATTAGGGAGG - Intergenic
907098661 1:51806616-51806638 TTATTTTACTCCTTTTAGGGAGG + Intronic
907657277 1:56357034-56357056 TGCTTTTATACATTTTAGGGAGG + Intergenic
908326852 1:63031501-63031523 TGCTTTTATACATTTTAGGAAGG + Intergenic
908492162 1:64656262-64656284 TGGTAATACACATTTGAGGAAGG + Intronic
908702045 1:66912612-66912634 TGGTTTTATACATTGTCGGGAGG - Intronic
908702622 1:66919112-66919134 TTGTTTTATACATTTTAGGGAGG - Intronic
908963283 1:69727736-69727758 TGGTTTTACATATTTTCTGTGGG + Intronic
909013976 1:70363836-70363858 TAGTTTTATACATTTTAGGGAGG + Intronic
909455174 1:75842039-75842061 TGGTTTTGTATATTTTAGGGAGG + Intronic
910193664 1:84619967-84619989 TGGTTTTATACATTTCAGGAGGG + Intergenic
910244439 1:85123457-85123479 TGCTTTTACACACTTGAGGAAGG - Intronic
910401680 1:86843624-86843646 TGGTTTTACACATTTTAGGAAGG + Intergenic
911023589 1:93413200-93413222 TGGTTTTATACATATTAGCGAGG + Intergenic
911047997 1:93644521-93644543 TGGTTTTATACATTTTAGGGAGG - Intronic
911107663 1:94149095-94149117 TGGTTTTATACATTTTAGGGAGG + Intronic
911514567 1:98851491-98851513 TGGTTTTACAAATTAAAGAGAGG + Intergenic
911539254 1:99138714-99138736 TGGTTTTACACATTTTAGGGAGG - Intergenic
912346432 1:108967402-108967424 TAGTTTTACATATTTTAGGGAGG + Intergenic
912620491 1:111151426-111151448 TGGTATTATACATTTTAGAGAGG + Intronic
913646742 1:120863347-120863369 TATTTTTACACATTATAGAGTGG - Intergenic
914079905 1:144399523-144399545 TATTTTTACACATTATAGAGTGG + Intergenic
914174809 1:145268058-145268080 TATTTTTACACATTATAGAGTGG + Intergenic
915672444 1:157501656-157501678 TGGTTTTATATATTTTAGGGAGG + Intergenic
915768799 1:158395956-158395978 TGGATTTACACATTTAAAAGGGG - Intergenic
915880579 1:159667139-159667161 TGGTTTTATATATTTTACAGAGG + Intergenic
915892854 1:159787667-159787689 TGGTTTTATACATTTTAGGGAGG + Intergenic
917117916 1:171621109-171621131 TGGTTTTATACATTTTAGAGAGG - Intergenic
917198309 1:172489779-172489801 TGGTTTTATACATTTCAAGGAGG + Intergenic
917198918 1:172495389-172495411 TGGTTTTATATATTTCAGGGAGG - Intergenic
917257681 1:173133162-173133184 TGGTTTTATACATTTTAGGAAGG - Intergenic
917625736 1:176844140-176844162 TAGTTTTACTCATTTTAGGAAGG + Exonic
918061582 1:181066141-181066163 TGGTTTTATATATTTGAGGGGGG - Intergenic
918460789 1:184774620-184774642 TGGTTTTATACATTTTAGGGAGG - Intergenic
918542468 1:185647535-185647557 TGGTTTTATACATTTTAGGGAGG + Intergenic
919705097 1:200668975-200668997 TGGTTTTATCTATTTTAGGAAGG - Intronic
920105672 1:203551598-203551620 TGGTTTTATACATTTTAGGGAGG + Intergenic
921797506 1:219363848-219363870 TGGATATACACAGTTTAGTGGGG + Intergenic
922025446 1:221744163-221744185 TGGTTTTATACATTTTAGGGAGG + Intergenic
922048989 1:221972575-221972597 TGTTTGTATACATTTTAGAGAGG - Intergenic
922202998 1:223422419-223422441 TGGTTTTATATACTTTAGGGAGG + Intergenic
922234161 1:223710904-223710926 TGGTTTTATACATGTTAGGGAGG - Intronic
922255961 1:223893153-223893175 TGGTTTTATGCATTTTAGAAAGG - Intergenic
922758756 1:228111017-228111039 TGGTTTTATACATTTTAGGGAGG + Intergenic
922813626 1:228433326-228433348 TGGTTTTATATATTTTAGGAAGG - Intergenic
923064893 1:230508767-230508789 TGGTTTTGTACATTTTAGGGAGG + Intergenic
923071821 1:230572624-230572646 TAGTTTTACACATTTTAGGGAGG + Intergenic
923380779 1:233415811-233415833 TGGTTTTATATATCTTAGGAAGG + Intergenic
923706623 1:236349442-236349464 TGGTTTTATATATTTTAGGGAGG + Intronic
923928078 1:238658738-238658760 TGGTTTTATACATTTTACAGAGG + Intergenic
923956635 1:239030058-239030080 TGATTTTATATATTTTAGGGAGG + Intergenic
924230349 1:241957437-241957459 GGGTGTTAAACATTTTAAGGAGG + Intergenic
924337160 1:242996020-242996042 TGGTTTTATGCATTTTAGAAGGG - Intergenic
924794328 1:247281698-247281720 CAGTTTTATACATTTTAGGGAGG + Intergenic
1063845305 10:10121185-10121207 TGGTTTTATGCATTTTAGGGAGG + Intergenic
1064174380 10:13061569-13061591 CGGTTTTATACATTCTAGGGAGG + Intronic
1064333587 10:14417262-14417284 TGGCTTCATACATTTTAGGGAGG + Intronic
1064542350 10:16417767-16417789 TGGTTTTATATATTTTAGGGAGG - Intergenic
1064570091 10:16683751-16683773 TGGTTTCATGCATTTTAGGGAGG + Intronic
1064637633 10:17385766-17385788 TGGTTTTATACATTTTAGGGAGG - Intronic
1064939004 10:20712237-20712259 TTGTTTTATGTATTTTAGGGAGG + Intergenic
1065128809 10:22600299-22600321 TGGCTTTACACATTTGAGCATGG - Intronic
1065156173 10:22872370-22872392 TGGTTTTATACATTTTAGAAAGG - Intergenic
1065414224 10:25467055-25467077 TGGTTTTATACATTTTAGGGAGG + Intronic
1065847261 10:29756014-29756036 TGGTTTTATATATTTTGGGGAGG - Intergenic
1066102678 10:32131950-32131972 GGGTTTTATACATTTTAGGGAGG - Intergenic
1066290737 10:34012426-34012448 TGATTTTATATATTTTATGGGGG - Intergenic
1066685702 10:37979420-37979442 TGATTTTATACATTGTAGGAGGG - Intergenic
1067529146 10:47057888-47057910 TGGTGTTGCACATTTTATGGGGG - Intergenic
1067758235 10:49023104-49023126 TGATTCTACACATTTTATGGTGG - Intronic
1068181621 10:53527148-53527170 TGGTTTTATATATTATAGGAAGG + Intergenic
1068404440 10:56571293-56571315 GGCTTTTTCTCATTTTAGGGAGG - Intergenic
1068438462 10:57020232-57020254 TGGTTTTATACATTTTAGGGAGG + Intergenic
1068830125 10:61484488-61484510 TGATTTTATACATTTTAGGTGGG + Intergenic
1069048406 10:63766676-63766698 TGGTTTTATATATTTTAGGGAGG - Intergenic
1069113545 10:64475968-64475990 TGGTTTTACAGATTTGAGCTGGG + Intergenic
1069178665 10:65327367-65327389 TGGTTTTATATATTTTAGGGAGG - Intergenic
1069329774 10:67278351-67278373 TGGTTTTATATATTTTGGGGAGG + Intronic
1069585674 10:69599899-69599921 TAGTTTTGTACATTTTGGGGAGG - Intergenic
1069732445 10:70626408-70626430 TTGTTTTATACATTTTGTGGGGG - Intergenic
1069925842 10:71850508-71850530 GGGTTTTACATATTTTCGGGAGG - Intronic
1070171892 10:73939258-73939280 TGGTTTTATACATTTTAGGGAGG - Intergenic
1070255573 10:74810881-74810903 TGGTTTAATACATTTTAGGGAGG + Intergenic
1070390434 10:75965876-75965898 GGTTTATACACATTATAGGGAGG + Intronic
1070573284 10:77657848-77657870 TGGTTTCATATATTTTAGGGAGG + Intergenic
1070905419 10:80068201-80068223 TGGTTTTATACATTTTAGAAAGG - Intergenic
1070956456 10:80466800-80466822 TTGTTTTATACATTTTAAGGAGG + Intronic
1070991505 10:80737103-80737125 TCGTTTTACACATTTTAGGGAGG - Intergenic
1071032145 10:81197430-81197452 TGATTTTGTACATTTTAGGCAGG - Intergenic
1071198925 10:83194976-83194998 TGGTTCTACACATTTTGGGGAGG - Intergenic
1071551155 10:86567163-86567185 TGCTTTTACACATTTTAGAGAGG + Intergenic
1071666063 10:87559747-87559769 TGGTTTTGTACATTTTAGGAAGG - Intergenic
1071674116 10:87638801-87638823 TTGGTTTATACATTTTAGGGAGG + Intergenic
1071863106 10:89696158-89696180 TGATTTTACACATTTTTGAGGGG - Intergenic
1072223081 10:93344127-93344149 TGGTTTTAGACATTTTCTAGGGG + Intronic
1072480041 10:95802096-95802118 TGGTTTTATATATTTTAGAGAGG + Intronic
1072972084 10:100026077-100026099 TGGTTTTATACATTTTAGAGAGG + Intergenic
1073644432 10:105285090-105285112 TTGTTTAAAACACTTTAGGGAGG + Intergenic
1073867739 10:107824482-107824504 TGGTTTTATACATTTTAGGGAGG + Intergenic
1073980533 10:109148583-109148605 TGGTTTTACATATTTTAGGGAGG + Intergenic
1074002050 10:109383233-109383255 TGGTTTTATACATTTTAGGGAGG - Intergenic
1074481082 10:113821330-113821352 TGGTTTTACACATTTTAGGGAGG + Intergenic
1074806153 10:117054906-117054928 CAGTTTTATACATTTCAGGGAGG - Intronic
1075016410 10:118912903-118912925 TGGTTTTCCACATATCAGGGAGG - Intergenic
1075546048 10:123355463-123355485 GGGTCTTACACTTTATAGGGTGG + Intergenic
1076430557 10:130398980-130399002 AGGTTTTATACATTTTAGGGAGG - Intergenic
1077466248 11:2735117-2735139 AGGTTTCACACGTTTTATGGGGG - Intronic
1077738223 11:4814969-4814991 TGCTTTTATACATTTTAGGAAGG + Intronic
1078000053 11:7486605-7486627 GGGTTTTGCACATTTTAATGAGG - Intronic
1078403304 11:11046312-11046334 TTTTTTAATACATTTTAGGGAGG + Intergenic
1079229949 11:18641078-18641100 TGATTTTATACATTTTAGGGAGG + Intergenic
1079420900 11:20286892-20286914 TTGTTTTATACATTTTAGGGAGG + Intergenic
1079515969 11:21269170-21269192 TGCATTTACACATTCTATGGTGG - Intronic
1079716617 11:23756036-23756058 TGGTTATACACATTGGTGGGGGG + Intergenic
1080072188 11:28102447-28102469 TGGTTTTTTATATTTTAGAGAGG - Intronic
1080292431 11:30686032-30686054 TGATTTCACACATTCTAGGCAGG - Intergenic
1080538069 11:33241371-33241393 TGGTGTTACAGGTTTTAGGGAGG + Intergenic
1081098925 11:38977727-38977749 TCATTTTATGCATTTTAGGGAGG + Intergenic
1081379622 11:42398756-42398778 TGGTTTTATACATTTTAGGGAGG + Intergenic
1082103279 11:48192197-48192219 TGGTTTTATACATTTTAGGGAGG - Intergenic
1082689535 11:56282811-56282833 GGTTTTTATACAGTTTAGGGAGG + Intergenic
1083055074 11:59811489-59811511 TGGCTTTATACATATTAGAGGGG + Intergenic
1083082977 11:60112777-60112799 TGGTTTTATATCTTTTGGGGAGG + Intergenic
1083105896 11:60358459-60358481 TGCTTTTATACATTCTAGGGAGG + Intronic
1083353123 11:62045153-62045175 TGGTTTTATACATTTTAGGGAGG + Intergenic
1083539408 11:63502008-63502030 TGGTTTTATACATTTTAGAGAGG - Intergenic
1084801136 11:71544964-71544986 TGGTTTTACACATTTTAGGGAGG - Intronic
1084933112 11:72572449-72572471 TGGTTTTATGTATTTTAGGAAGG + Intergenic
1085564739 11:77503211-77503233 TGGTTTTACACATTGCAGTTTGG - Intergenic
1085815540 11:79733361-79733383 TGGTCTTAGAGAATTTAGGGAGG + Intergenic
1085831148 11:79902116-79902138 TGATTTTATACATTTAAGGGGGG - Intergenic
1086040906 11:82477622-82477644 TGGTTTTATATGTTTTAGAGAGG - Intergenic
1086460131 11:86997866-86997888 TGGTTTTACACATTTTAGGGAGG + Intergenic
1086470026 11:87098313-87098335 TTGTTTTAAATATTTTAGGTTGG + Intronic
1086501935 11:87462642-87462664 TGGTTTTGTACATTTTAAGGAGG + Intergenic
1087023891 11:93630684-93630706 TATTTTTACACATCTGAGGGAGG + Intergenic
1087471982 11:98587175-98587197 TGGTTTTATACATTTTAGGGAGG + Intergenic
1088008872 11:104974567-104974589 TGGTTTTATACATTTTAGGGAGG + Intergenic
1088178068 11:107076536-107076558 TGGTTTTGTATAATTTAGGGAGG - Intergenic
1088948645 11:114541575-114541597 TGGTTATATACATTTTGGGGAGG + Intronic
1089864123 11:121616869-121616891 TGGTTTTATACATTTTAGGGAGG + Intronic
1090108408 11:123876707-123876729 TGGTTTTATACATTTTAGGGAGG - Intergenic
1090540599 11:127699231-127699253 TGGAGTTAAACATTTTTGGGAGG + Intergenic
1091224560 11:133949826-133949848 TGGTTTTCCCCCTTTGAGGGGGG - Intronic
1091257124 11:134198454-134198476 TGGTTTTATACACTTTAGGGAGG - Intronic
1091757955 12:3067621-3067643 TGGTTTCACACCTTTCAGGGAGG - Intergenic
1092594323 12:9984999-9985021 TGGTTCTACATATTTTAGGGAGG + Exonic
1092613745 12:10197705-10197727 TGGTTTTATACATTTTAGGTAGG - Intergenic
1094018404 12:25887776-25887798 TGGTTTTATACATTTTAGAGAGG - Intergenic
1094588653 12:31800876-31800898 TGGTTTTATACATTTTAGGGAGG + Intergenic
1094618437 12:32057352-32057374 TGGGTTTATACATTTTAGGGAGG - Intergenic
1094644694 12:32311155-32311177 TGGTTTTATATATTTTAGGGAGG + Intronic
1095231140 12:39741633-39741655 TGGTTTTACACATTTTAGGGAGG + Intronic
1095256456 12:40042197-40042219 TGGTTGTACATAGTTTAGTGAGG + Intronic
1095269017 12:40194450-40194472 TGGTTTTATACATTTTAGGGAGG + Intergenic
1095643522 12:44513227-44513249 TGGCTTTACACCAGTTAGGGGGG - Intronic
1096034087 12:48448888-48448910 TGGTTTTATACATTTTAGGGGGG + Intergenic
1096049348 12:48593584-48593606 TGGTTTTATATATTTTAGGGAGG - Intergenic
1096094290 12:48924454-48924476 GGGTCTTACTCATTTCAGGGGGG + Intronic
1097005078 12:55910739-55910761 TGGTTTTATATATTTTAGGGAGG + Intronic
1097595919 12:61630707-61630729 TGGTTTTATACATTTTAGGGAGG + Intergenic
1098118818 12:67212462-67212484 TGGTCACACACATTTTAGGTAGG + Intergenic
1098182548 12:67863270-67863292 TGGTTTTATACATTTTAGGGAGG + Intergenic
1098183434 12:67871942-67871964 TTGTTTTATACATTTTAGACAGG + Intergenic
1098192828 12:67968225-67968247 TGGATTTACATATTTTTTGGAGG + Intergenic
1098310105 12:69140119-69140141 TGGTTTAATATATTTTAGGGAGG - Intergenic
1098316174 12:69195568-69195590 TGGTTTTATATATTTTAGGGAGG + Intergenic
1099094406 12:78355675-78355697 TGGTTTTATATATTTTAAGGAGG + Intergenic
1099443429 12:82725652-82725674 TGGTTTTATACATGTTAGGGAGG + Intronic
1099798846 12:87432079-87432101 TGGTTTTATATATTTTAGGAAGG + Intergenic
1100203890 12:92327617-92327639 TGATTTTCCCCATTTTATGGAGG + Intergenic
1100264729 12:92964730-92964752 TGGTTTTATACATTTTAGAGAGG - Intergenic
1100619250 12:96255706-96255728 TGGTTTTATATATTTTAGGGAGG + Intronic
1100855251 12:98752169-98752191 TGGCTTTATACATTTTAGGGAGG - Intronic
1100978798 12:100148273-100148295 TGGTTTTATACATTTTAGGGAGG - Intergenic
1101088345 12:101258991-101259013 CAGTTTTACACATTTTAGGGAGG + Intergenic
1101855760 12:108441454-108441476 TGGTTTTATACATTTTAGGGAGG - Intergenic
1102390290 12:112544136-112544158 TGGTTTGATGCATTTGAGGGTGG + Intergenic
1104103511 12:125637479-125637501 TGGTTTTATACATTTTAGGGAGG + Intronic
1104204127 12:126620051-126620073 TGACTTTATACATTTTAGGGAGG + Intergenic
1104277384 12:127342032-127342054 TGCTTTTATGCTTTTTAGGGAGG - Intergenic
1104355404 12:128080743-128080765 TGGTTTTATACATTTCAGGGAGG - Intergenic
1104380166 12:128300384-128300406 TGGTTTTTCTCATTTGAAGGAGG + Intronic
1104449684 12:128859052-128859074 TGGTTTTACACATTTTAGGGAGG - Intronic
1105316100 13:19265229-19265251 TGGTTTTATATATCTTAGGAAGG - Intergenic
1105748245 13:23397857-23397879 TGGTTTTATATATTTTAGAGAGG + Intronic
1105885652 13:24638757-24638779 TGTTTTTATACATTTTAGGGAGG + Intergenic
1106119814 13:26850913-26850935 TGGTTTTATATATTTTAGGGAGG - Intergenic
1106123014 13:26877522-26877544 TGCTTTTATATATTTTAGGGAGG + Intergenic
1106207833 13:27616072-27616094 TGGTTTTATACATTTTAGGGAGG + Intronic
1106429118 13:29662788-29662810 TGGTTTTATATACTTTTGGGAGG - Intergenic
1106796779 13:33214902-33214924 TGGTTGTACACATTTTTTGCAGG - Intronic
1106944382 13:34810486-34810508 TGATTTTATACATTTCAGGAAGG - Intergenic
1107079238 13:36356667-36356689 TGGTTTTATACATTTTAGGGAGG - Intronic
1108047004 13:46392651-46392673 TGGTTTTATACATTTTAGAGAGG - Intronic
1108258071 13:48629668-48629690 TGGTTATATACATTTTAGGGAGG + Intergenic
1108279972 13:48851573-48851595 TGATTTTTTACATTTTAGGGAGG - Intergenic
1108379571 13:49843203-49843225 TGGTTTTATACATTTTAGGGAGG - Intergenic
1109102909 13:58209150-58209172 TCGTTTTATATATTTTAAGGAGG + Intergenic
1109725690 13:66338403-66338425 AGGTTTTACAAATTTTATGATGG + Intronic
1109963469 13:69661256-69661278 TGGTTTTATGTATTTTAGGGGGG - Intergenic
1110058856 13:71015457-71015479 TGGTTTTATATATTTTAGGGAGG + Intergenic
1110184133 13:72654004-72654026 TGGTCTAAAACATTTTTGGGGGG - Intergenic
1110530896 13:76596334-76596356 TGGTTTTACTCATCTTAGTGAGG + Intergenic
1110592973 13:77286159-77286181 TTCTTTTGCACATTTTATGGTGG - Intronic
1110815956 13:79860167-79860189 TGATTTTATACATTTTAAGGAGG + Intergenic
1110867816 13:80417225-80417247 TGTTTCTCCAGATTTTAGGGTGG + Intergenic
1110921377 13:81090694-81090716 TGGTTTCATACATTCTAGGAAGG + Intergenic
1111122485 13:83871859-83871881 TGGTTTTATATATTTTAGGGAGG - Intergenic
1111472707 13:88705934-88705956 TGGTTTTACATATTTTAAGGAGG + Intergenic
1111731028 13:92077163-92077185 TGGTTTTATACATTTTAGGGAGG - Intronic
1112280808 13:98061430-98061452 TGGTTTTATATATTTTAGGGAGG - Intergenic
1112281616 13:98067632-98067654 TAGTTTTAAAAATTTTAGAGAGG - Intergenic
1112592194 13:100773994-100774016 TTTTTTAATACATTTTAGGGAGG + Intergenic
1112672460 13:101655957-101655979 TGGTTTTATCTATTTTAGGATGG + Intronic
1113218298 13:108069061-108069083 TGGTTTTATATATTTTAGGGAGG - Intergenic
1113390337 13:109890412-109890434 TGGTTTTATACATTTTAGGGAGG + Intergenic
1113740527 13:112709739-112709761 TGGTTTTATACATTTTAGGGAGG - Intronic
1113742774 13:112722804-112722826 GGATGTTACACATTTCAGGGAGG + Intronic
1113829181 13:113281531-113281553 TGGTTTTACACATTTTAGGGAGG + Intergenic
1114205403 14:20566865-20566887 TGGTTTTATATATTTTAGGGAGG + Intergenic
1114229455 14:20767462-20767484 TGGTTTTATACATTTTAGAGAGG - Intergenic
1114387478 14:22269963-22269985 TTGGCTTATACATTTTAGGGAGG + Intergenic
1114504545 14:23199206-23199228 TAGTTTTATACATTTTAGGGAGG + Intronic
1114874653 14:26700705-26700727 TGATTTTATACATTTTAGAGAGG + Intergenic
1114998310 14:28388199-28388221 TGGTTTTATACATTTTAGAGAGG + Intergenic
1115617809 14:35113002-35113024 TGGTTTCATACATTTTAGGGAGG - Intronic
1116131865 14:40864947-40864969 TGGTTTTATACATTTTAGAGAGG - Intergenic
1116351582 14:43870591-43870613 TAGTTTTATACATTTTAGAGAGG + Intergenic
1116471892 14:45295258-45295280 TGGTTTTATACATTTTAGGGAGG - Intergenic
1117209640 14:53482139-53482161 TGGTTTTATACATTTTAGAGAGG + Intergenic
1117691012 14:58306004-58306026 TGGGATTTCACATTTTAGGTTGG + Exonic
1117861970 14:60101234-60101256 TAGTTTTATATATTTTAGGGAGG - Intronic
1118112541 14:62737758-62737780 TGTTTTTAGACATTTTAAAGTGG - Intronic
1118121477 14:62848990-62849012 TGGTTTTATTTATTTTAAGGAGG + Intronic
1118132975 14:62988415-62988437 TGGTTTGACAGATATTAGGCAGG - Intronic
1118158540 14:63265704-63265726 TGATTTTATGCATTTTAGGGGGG + Intronic
1118491504 14:66265362-66265384 TGATTTTATACATTTTAGCAGGG + Intergenic
1119059329 14:71459109-71459131 TGTTGATACACATTTTAGGAAGG + Intronic
1120155781 14:81091682-81091704 TTGTTTTACACCTTATAAGGTGG - Intronic
1120357827 14:83456979-83457001 TGATTTTATACATTTTAGGAGGG - Intergenic
1120425090 14:84337467-84337489 TGGTTTCATACATTTTAGGGAGG - Intergenic
1120690061 14:87582305-87582327 TGATTTTATACATTTTAGAGAGG - Intergenic
1120694874 14:87633368-87633390 TGGTTTTGTACATTTTAGGGAGG + Intergenic
1120771329 14:88383602-88383624 TGGTTTTATACATTTTAGGGAGG + Intergenic
1120974804 14:90239193-90239215 TGGTTTTACATATTTTAGGAAGG - Intergenic
1121268492 14:92621436-92621458 TGGTTTTATAGATTTTAGGGAGG + Intronic
1121731536 14:96190635-96190657 TGGTTTTATACATTTTAGGGAGG + Intergenic
1122062447 14:99145089-99145111 TGGTTTTACACATTTTAGGAAGG - Intergenic
1122187282 14:100009760-100009782 TAGTTTTATATATTTTAGGAAGG + Intronic
1122646625 14:103198614-103198636 TGGTTTAACACATTTCAGGGAGG + Intergenic
1122709262 14:103643582-103643604 TGGTTTTATACATTTTAGAGAGG + Intronic
1122832631 14:104407957-104407979 TGGTTTTATACATTTTAGGGAGG + Intergenic
1122927312 14:104911130-104911152 TGGTTTTATACATTTTAGGGAGG - Intergenic
1123128053 14:105963871-105963893 TGGTTTTATACATTTTAGAGAGG - Intergenic
1123888918 15:24756087-24756109 TGGTTTTATACATTTTAGGGAGG + Intergenic
1124033142 15:26029559-26029581 TGATTTTATATATTTTAGGGAGG + Intergenic
1124033619 15:26033318-26033340 TGGTTTTATACATTCTAGGGAGG + Intergenic
1124208889 15:27746004-27746026 TGGTTTTATACATTTTAGGGGGG - Intergenic
1125451624 15:39814022-39814044 TGGTTGCAAACATTTTAGTGAGG - Intronic
1125878428 15:43169848-43169870 GGGATTTATACATTTTATGGAGG + Intronic
1126118030 15:45226612-45226634 TGGTTTTATATATTTTAGGGAGG + Intergenic
1126124772 15:45285327-45285349 TGGTTTTATATATTTTTAGGGGG - Intergenic
1126644963 15:50866808-50866830 AGGTTTTATATATTTTAGGGAGG + Intergenic
1126645937 15:50874839-50874861 CGGTTTTATATATTTTAGGGAGG + Intergenic
1126662375 15:51045629-51045651 TGGTTTTATACATTTTAGGAAGG - Intergenic
1127507280 15:59609600-59609622 TGATTTTATACATTTTAGAGAGG - Intronic
1127851250 15:62913784-62913806 TGGTTTTATACATTTTAGAGAGG + Intergenic
1128456948 15:67836359-67836381 TGGTTATTAACATTTTTGGGGGG - Intergenic
1128575736 15:68773620-68773642 AGGTGTTACACATTTTGGTGAGG - Intergenic
1128601554 15:68999363-68999385 TGGTGCTATACATTTTAGGGAGG + Intronic
1128849798 15:70942717-70942739 TGGTTTTATACATTTTAGGGAGG + Intronic
1128864558 15:71104631-71104653 TGGTTGTATAAATTTTAGGGAGG + Intronic
1130431792 15:83855768-83855790 TGTTTTTACTGATTTTATGGAGG + Intronic
1130526924 15:84715697-84715719 TTGTTTTAGTCATTTTAAGGCGG - Intronic
1131001020 15:88940279-88940301 TGGTTTTACACATTTCAGGAAGG + Intergenic
1131636480 15:94238048-94238070 TGATTTTATACATTTTAGAGAGG - Intronic
1133800040 16:9077866-9077888 TGGTTTTATATATTTTAGGGAGG + Intergenic
1133949602 16:10379916-10379938 TGGTTTTATACATTTTAGGGAGG + Intronic
1134279937 16:12808466-12808488 TGGTTTTATACATTCTAGGGAGG - Intergenic
1134328937 16:13232599-13232621 TGGTTTTATACATTTTAGGGAGG + Intronic
1134381153 16:13727364-13727386 TTTTATTACACATTTTAGGCAGG - Intergenic
1134397126 16:13875372-13875394 TGGTTTTATACATTTTAGGGAGG - Intergenic
1135225183 16:20649791-20649813 TGGTTTTGTATATTTGAGGGAGG - Intronic
1135226150 16:20660001-20660023 TGGTTTTATATATTTTAGGGAGG - Intronic
1135229484 16:20692278-20692300 TGGTTTTATATACTTTAGGAAGG + Intronic
1135638458 16:24099492-24099514 TGGTTTTACATGTTCTGGGGAGG + Intronic
1136693060 16:32050374-32050396 TGGTTTTATACAATTTAGGGAGG - Intergenic
1136793554 16:32993600-32993622 TGGTTTTATACAATTTAGGGAGG - Intergenic
1136876358 16:33860787-33860809 TGGTTTTATACAATTTAGGGAGG + Intergenic
1137061716 16:35796422-35796444 TGGTTTTATACATTTTAGAGAGG - Intergenic
1137884489 16:52087951-52087973 TGGTTTTATATATTTTAGGGAGG - Intergenic
1138296746 16:55892345-55892367 TGGTTTTATGCATTTTAGGGAGG - Intronic
1138972018 16:62156669-62156691 TTGTTTTATACATTTTATTGGGG - Intergenic
1138995397 16:62445642-62445664 TAGTTTTATATATTTTAGGGAGG - Intergenic
1140054307 16:71512068-71512090 TGGTTTTATATATTTTAGGGAGG + Intronic
1140458491 16:75118600-75118622 TGGTTTTATACAGTTTAGGGAGG - Intergenic
1140500498 16:75429954-75429976 TGGTTTTATATATTTTAGGGAGG + Intronic
1140747298 16:77992277-77992299 TGGTTTTATATATTTTAGGGAGG + Intergenic
1140917918 16:79510126-79510148 TTGTTGTACCCATTTTATGGAGG - Intergenic
1141177241 16:81729143-81729165 TGTTTTTATACATTTTAGGGAGG - Intergenic
1141304729 16:82851517-82851539 TGGTTTTACAGTTCTTGGGGAGG - Intronic
1203095816 16_KI270728v1_random:1255290-1255312 TGGTTTTATACAATTTAGGGAGG - Intergenic
1142464831 17:129292-129314 TGGTTCTATACATTTTAGGGAGG - Intergenic
1143803698 17:9407578-9407600 TGGTTTTATACATTTTAGAGAGG + Intronic
1145223605 17:21109137-21109159 TGGTTTTATACATTTTAGGGAGG - Intergenic
1145285316 17:21501481-21501503 TGGTTGTACATATTTTGAGGAGG - Intergenic
1145392204 17:22464261-22464283 TGGTTGTATACATTTTAAGGAGG + Intergenic
1145871003 17:28272977-28272999 TGGTTTTATATATTTCAGGGAGG - Intergenic
1146103212 17:30006077-30006099 TGGTTTTATACATTTTAGGGAGG - Intronic
1146238621 17:31192307-31192329 TGGTTTGATATATTTTAGGAAGG + Intronic
1146811212 17:35905144-35905166 TCGTTTTATACATTTTAGAGAGG + Intergenic
1146925692 17:36743284-36743306 TGGGTTTACATATTTACGGGAGG - Intergenic
1147379998 17:40048966-40048988 TGGTTTTATACATTTTAGGGAGG + Intronic
1148220412 17:45857956-45857978 TGGTTTGACAAATGGTAGGGAGG - Intergenic
1149152922 17:53591729-53591751 TTATTTTACACTTTTTGGGGAGG - Intergenic
1150909126 17:69369986-69370008 TGGTTTTATACATTTTAGAGAGG + Intergenic
1150956169 17:69862731-69862753 TGGTTTTATACATTTTAGAGCGG - Intergenic
1151132896 17:71916562-71916584 TGGTTTTATACATTGTAGGGAGG - Intergenic
1151914874 17:77110533-77110555 TTGGTTTAAACATTTTAGAGAGG + Intronic
1153042987 18:831608-831630 TGGTTTTATACATTTTAGAGGGG - Intergenic
1153136171 18:1920040-1920062 TGTTTTTATATATTTTAGGGAGG + Intergenic
1153138263 18:1942198-1942220 TGGTTCTATATATTTTAGGAAGG + Intergenic
1153157164 18:2162779-2162801 TGGTTTTATACATTTTAGAGGGG - Intergenic
1153279646 18:3402181-3402203 TGGTTTTAGACATCTGAGAGGGG + Intergenic
1153345964 18:4026419-4026441 GGGTTTTGCACTTTTCAGGGTGG + Intronic
1153415897 18:4845318-4845340 TGGTTTTATATATTTTAGGGAGG - Intergenic
1153572666 18:6488682-6488704 TGGTTTTATTTATTTTAGGGAGG - Intergenic
1153832633 18:8936657-8936679 TTGTTTTGTACACTTTAGGGAGG + Intergenic
1153837504 18:8977122-8977144 TGGTTTTACACATTTTAGGGAGG + Intergenic
1154363531 18:13685699-13685721 TGGCTTTAAACGTTTTAGGGAGG - Intronic
1154375516 18:13806133-13806155 TGGTTTTGTATATTTTAGGAAGG + Intergenic
1155298838 18:24410226-24410248 TGGTTTTATACATTTTAGGGCGG - Intergenic
1155422859 18:25674260-25674282 TTATTTTAGCCATTTTAGGGGGG + Intergenic
1155565713 18:27132010-27132032 TGGTTTTATACATTTTAGGGAGG - Intronic
1155864447 18:30947504-30947526 TGCTTTTACACATTTTACCAGGG + Intergenic
1155954844 18:31948271-31948293 TGGTTTTATACATTTTAAGGAGG + Intronic
1156082675 18:33357186-33357208 TGATTTTATACATTTTAGGGGGG - Intronic
1156191160 18:34722043-34722065 TTTTTTTAAACATTTTAGGAAGG - Intronic
1156311170 18:35923401-35923423 TGGTTTTATACATTTTACAGAGG + Intergenic
1156585665 18:38428266-38428288 TGGTTTTATATATTTTACAGAGG + Intergenic
1156779398 18:40833193-40833215 TGGTTTTATTCCTTTTATGGCGG - Intergenic
1156942081 18:42780154-42780176 TGATTTTATATATTTTAGGGAGG + Intronic
1156973995 18:43194117-43194139 TGGTTTTATATGTTTTAGGGAGG + Intergenic
1157163717 18:45338576-45338598 TGTTTTTATACACTTTAGAGAGG - Intronic
1157428727 18:47605721-47605743 TGGTTTTATATATTTTAGGGAGG + Intergenic
1157909744 18:51604544-51604566 TTGTTTTATACGTTTTAGAGAGG + Intergenic
1158006306 18:52675511-52675533 TGGTTATACACATTTTAGGGAGG - Intronic
1158084599 18:53635896-53635918 TGGTTTTACACATTTTAGGGAGG - Intergenic
1158093137 18:53738872-53738894 TGGTTTTACACATTTTAGGGAGG - Intergenic
1158664026 18:59416193-59416215 TGGTTTTATACGTTTTAGGGAGG + Intergenic
1158864578 18:61625861-61625883 TGGTTTTATACATTTTAGGGGGG - Intergenic
1158866207 18:61639806-61639828 TGGTTTTGTACATTTCAGGGAGG + Intergenic
1158871421 18:61692130-61692152 TGGTTTTATACATTTTAGGGAGG + Intergenic
1158894156 18:61897537-61897559 TGGTTTTATACATTTTAGGGAGG + Intergenic
1159207947 18:65278512-65278534 TCATTTTATACATTTTAAGGGGG + Intergenic
1159594301 18:70367998-70368020 TGGTTTCATACATTTTAGGGAGG - Intergenic
1159786328 18:72718745-72718767 TGGTTTTATACATTTTAGGGAGG - Intergenic
1159937902 18:74383147-74383169 TGATTTTATACATTTTAGAGAGG + Intergenic
1160598147 18:79991909-79991931 TAGTTTTATACATTTTAGGGAGG + Intronic
1161919885 19:7258120-7258142 TGCTTTTTCACATTTTTGGCCGG - Intronic
1162072844 19:8165202-8165224 TGGTTTGATACATTTTAGGGAGG - Intronic
1164277652 19:23735093-23735115 TGGTTTTATATAAGTTAGGGAGG + Intergenic
1164410112 19:27995631-27995653 TGCTTTTATACATTCAAGGGAGG - Intergenic
1164487197 19:28668615-28668637 TGGTTTTAAATATAGTAGGGTGG - Intergenic
1164995543 19:32718561-32718583 TGGTCTTTTACATTTTAGGGAGG - Intergenic
1165368904 19:35389909-35389931 TGGTTTTATACATTTTAAGGAGG + Intergenic
1165597669 19:37024283-37024305 TTGCTTTACACATTTTAGAGAGG - Intronic
1166157931 19:40928916-40928938 TGCTTTTAAACATCTTAAGGTGG + Intergenic
1166418306 19:42612359-42612381 TGGTTCTATACATTTTAGGGAGG - Intronic
1167680964 19:50920848-50920870 TGGTTTCGTACATTTTAGGAAGG + Intergenic
1167700778 19:51043966-51043988 TTGGTTTATGCATTTTAGGGAGG + Intergenic
1167799923 19:51733707-51733729 TGATTTGATGCATTTTAGGGAGG + Intergenic
1167907136 19:52670708-52670730 TCTTCTTAGACATTTTAGGGAGG + Intronic
1167943199 19:52963823-52963845 TGTTCTTAGACATTTTAGGGAGG + Intergenic
1167947373 19:52999425-52999447 TGGTTTTGTACATTCTAGAGAGG - Intergenic
1168084454 19:54035064-54035086 TGGTTTTATACATTTTAGGGAGG + Intergenic
1168498218 19:56871948-56871970 TGGTTTTATACATTTTAGGGAGG - Intergenic
1168518487 19:57029182-57029204 TGGTTTTCCTAATTTTTGGGGGG - Intergenic
1168613353 19:57818479-57818501 TGGTTTAATACATTTTAGGGGGG + Intronic
1168622724 19:57892095-57892117 TGGTTTTATACATTTTAAGGAGG - Intronic
925055275 2:852414-852436 TGGTCGTATACATTTTAGGGAGG + Intergenic
925163509 2:1702895-1702917 TGGTTTTATACATTTTAGGGAGG + Intronic
925176409 2:1787289-1787311 TGATTTTATACATTTTAGGGAGG - Intergenic
925800212 2:7591663-7591685 TGGTTTTATACATTTTAGAGAGG + Intergenic
925811150 2:7702186-7702208 TGGTTTTATACATTTCAGGAAGG - Intergenic
925869213 2:8254674-8254696 TGGTTTTATACATTTGAGGGAGG - Intergenic
927125552 2:20009939-20009961 TGTTTTTATACAATTTAAGGAGG - Intronic
927718954 2:25370966-25370988 TGGTTTTATACATTTTAGAGAGG - Intergenic
927748772 2:25646759-25646781 TGGTTTTATACATCTTAAGGAGG - Intronic
928682147 2:33713677-33713699 TGGTTTTATGTATTTTAGGAAGG + Intergenic
928716116 2:34062850-34062872 TAGTTTTATACATTTTAGAGAGG + Intergenic
928794742 2:35004399-35004421 TGGTTTCATATATTTTAGGAAGG - Intergenic
929111087 2:38405768-38405790 TGGTTTTATACATTTTAGGGAGG - Intergenic
929435930 2:41928276-41928298 GGGTTTTATACATTTTAGGGAGG + Intergenic
929657579 2:43749397-43749419 TGGTTTTACGCATTTTACGGAGG - Intronic
929749605 2:44696237-44696259 TGTTTTTAAACATTTTTGGCCGG - Intronic
930467816 2:51776509-51776531 TGGTTTTACACAGTTTAGGGAGG + Intergenic
931042125 2:58312500-58312522 TGATTTTATACATTTTAAGGGGG + Intergenic
931284798 2:60822969-60822991 TGCTTTTATACATTTTAGAGAGG + Intergenic
931317014 2:61142442-61142464 TGGTTTTATACATTTTAGGGAGG + Intergenic
931416754 2:62088847-62088869 TGGATTTATGTATTTTAGGGAGG + Intronic
931418116 2:62100453-62100475 TGGTTTTATACATTTTAGGGAGG + Intronic
931541418 2:63333726-63333748 TGGTTTTATATATTTTAGGGAGG - Intronic
931554936 2:63492302-63492324 TTGTTTTTCACAATTTTGGGGGG - Intronic
931710650 2:64987382-64987404 TGGTTTTGAACATTTTAGTTGGG + Intergenic
932033593 2:68216408-68216430 TTGTTTTTCACATTTTAGGGAGG - Intronic
932058595 2:68471923-68471945 GGTTTTTATATATTTTAGGGAGG + Intronic
933066420 2:77804609-77804631 GGGTTTCATACATTTTAGGATGG + Intergenic
933066822 2:77808196-77808218 TGGTTTTATATATTTTAGGAAGG - Intergenic
933329153 2:80875371-80875393 TGGCTTTATATATTTCAGGGAGG - Intergenic
933514495 2:83283601-83283623 TGGTTTTATGTATTTTAGGAAGG - Intergenic
933613681 2:84462396-84462418 TGCTTTTATACATTTTAGGAAGG - Intergenic
933939045 2:87230379-87230401 TGGTTTTATACATTTTAGAGAGG + Intergenic
934132504 2:88962212-88962234 TGATTTTACATATTTTAGAGAGG - Intergenic
934135135 2:88988404-88988426 TGATTTTACATATTTTAGAGAGG - Intergenic
934136998 2:89005668-89005690 TGATTTTACATATCTTAGAGAGG - Intergenic
934146160 2:89095946-89095968 TGACTTTACATATTTTAGAGAGG - Intergenic
934147879 2:89113313-89113335 TGATTTTACATATTTTAGAGAGG - Intergenic
934155729 2:89198314-89198336 TGGTTTTATACATTTTAGAGAGG - Intergenic
934211592 2:89984445-89984467 TGGTTTTATACATTTTAGAGAGG + Intergenic
934221399 2:90087295-90087317 TGACTTTACATATTTTAGAGAGG + Intergenic
934223104 2:90104629-90104651 TGACTTTACATATTTTAGAGAGG + Intergenic
934234107 2:90214821-90214843 TGATTTTACATATCTTAGAGAGG + Intergenic
934235174 2:90225357-90225379 TGATTTTACATATTTTAGAGAGG + Intergenic
935181612 2:100695805-100695827 TGGTTTTACACATTCTAGGGAGG + Intergenic
935612096 2:105036467-105036489 TGATTTTATACATTTTAGGGAGG + Intergenic
935722012 2:105987845-105987867 TGGTTTTATACATTTTAGGGAGG + Intergenic
935740991 2:106147718-106147740 TAGTTTTATACATTTTAGAGAGG - Intronic
935874600 2:107493245-107493267 TGGTTTTACACATTTTAGGGAGG + Intergenic
936354088 2:111735396-111735418 TGGTTTTATACATTTTAGAGAGG - Intergenic
936677719 2:114734540-114734562 TGGTTTTATATATTTCAGGGAGG - Intronic
936706985 2:115086797-115086819 TGGTTTTATATATTTTAGGGAGG - Intronic
937595119 2:123662933-123662955 TGCTTTTATATATTTTAGGGAGG - Intergenic
937644368 2:124249650-124249672 TGGTTTTATATATTCTAGGAAGG - Intronic
938060582 2:128251432-128251454 TGGTTTTATACATTTTAGGGAGG + Intronic
938250845 2:129814379-129814401 TGGTTTTATGTATTTTAGGAAGG + Intergenic
938371289 2:130769955-130769977 TGGTTTTATGCATTTTAGGGAGG + Intergenic
938739906 2:134221209-134221231 TGGTTTTATGTATTTTAGGAAGG + Intronic
938875396 2:135527052-135527074 TGGTTTTATGTATTTTAGGAAGG - Intronic
939061776 2:137431127-137431149 TGGTTTTATCCGTTTTAGAGAGG + Intronic
939233902 2:139466889-139466911 TTGGTTAATACATTTTAGGGAGG + Intergenic
939250357 2:139674183-139674205 TGGTTTTATACATTTTAGGAAGG - Intergenic
939340282 2:140886000-140886022 TGATTTTACATATATGAGGGAGG + Intronic
939755959 2:146111381-146111403 TGTTTTTACACCTTTTAAGAAGG + Intergenic
940209898 2:151245536-151245558 TAGTTTTACATATTTTAGGAAGG + Intergenic
941632662 2:167902096-167902118 TGGTTTTTGCCATTTTAGGTTGG - Intergenic
941863562 2:170310320-170310342 TAGTTTTATACATTTTAGGGAGG + Intronic
942097809 2:172549775-172549797 TGGTTTTATACATTTTAGGGAGG + Intergenic
942172618 2:173302692-173302714 TGGTTTTATACATTTTAGGGAGG + Intergenic
942174446 2:173318511-173318533 TGGTTTTATACATTTTAGAGAGG + Intergenic
942294559 2:174505175-174505197 TGTTTTTACACATTTTAGGGAGG + Intergenic
942625396 2:177894955-177894977 TGGTTTTATACATTTTAGGGAGG - Intronic
943262199 2:185680164-185680186 TTGTTTTATACATTTTAGGGAGG + Intergenic
943481524 2:188426050-188426072 TGGTTTTATATATTTGAAGGAGG + Intronic
943801257 2:192060969-192060991 TGTATTTAATCATTTTAGGGAGG + Intronic
943984407 2:194601824-194601846 TGGTTTTATACATTTTAAGAAGG + Intergenic
944124944 2:196282457-196282479 TGGTTTTATACATTTTAGAGAGG + Intronic
944516777 2:200520517-200520539 TGGTTTTATACATTTTAAGGAGG + Intronic
944720487 2:202418539-202418561 TGATTTTATACATTTTAGGGTGG + Intronic
944774144 2:202944957-202944979 TGGTTTTACATTGTTTAGGTAGG + Intronic
945743154 2:213688009-213688031 TGGTTTTATACATTTTAGGGAGG + Intronic
945925643 2:215800539-215800561 TGGTTTCATACATTTCAGGGAGG - Intergenic
947020236 2:225666437-225666459 TGCTTTTATACATTTTAGGGAGG + Intergenic
947171807 2:227320109-227320131 TGGCTTTACATATTTTAAGGAGG + Intergenic
947172325 2:227324309-227324331 TGGTTTTATGTATTTTAGGGAGG - Intergenic
947300288 2:228681853-228681875 TGGTTTTGCACATTTTTGGGGGG + Intergenic
948016375 2:234694158-234694180 TGGTTTTATACATTTTAGGGAGG - Intergenic
948020081 2:234724793-234724815 TGGTTTTATATATTTTAAGGAGG + Intergenic
948376813 2:237526084-237526106 TGGTTCTAGTCATTTCAGGGAGG - Intronic
948819740 2:240535182-240535204 TGGTTTTATATGTTTTAGGGAGG + Intronic
948843334 2:240670643-240670665 TGATTTTGTACATTTTAGGAGGG - Intergenic
1168823096 20:790068-790090 TGGTTTTATACATTTTAGAGAGG + Intergenic
1168824878 20:803446-803468 TGGTTTTGTATATTTTAGGAAGG + Intergenic
1168843756 20:927630-927652 TGATTTTATACATTTTAGGGAGG + Intergenic
1169304394 20:4475835-4475857 TGGTTTTATATATTTTAGGAAGG + Intergenic
1169324053 20:4661069-4661091 TTGTTTTATACATTTTAGGGAGG + Intergenic
1170283072 20:14673454-14673476 TGATTTTACAGATTTGAGGCTGG + Intronic
1170564349 20:17588359-17588381 TGATTTTACACATTTTAGGTGGG - Intronic
1170936615 20:20815613-20815635 TGATTTTATACACTTTAGGAGGG + Intergenic
1172600795 20:36181428-36181450 TGGTTTTTCACATCTAAGTGTGG + Intronic
1172796152 20:37539779-37539801 TGGTTTCATACATTTTAGGGAGG + Intergenic
1173897366 20:46561269-46561291 TGATTTTATACATTTTAGGGAGG - Intronic
1174573785 20:51523265-51523287 TGGTCTTCCACATCTTGGGGGGG + Exonic
1174850413 20:53988531-53988553 TAGTTTTACATATTTTCGGGGGG + Intronic
1175612153 20:60360579-60360601 TGGTTTTACATGTTTGAGAGAGG - Intergenic
1175635387 20:60578550-60578572 TGATTTTATACATTTTAGGGGGG + Intergenic
1176095386 20:63341374-63341396 TGGTTTTATGGATTTTAGGGAGG - Intergenic
1176362237 21:6007390-6007412 TGGCTTTATACATTTTAGAGAGG + Intergenic
1176703732 21:10093110-10093132 TGCTTTTATACATTTTAGAGAGG + Intergenic
1176727747 21:10456025-10456047 TGGAATTACATATTTTTGGGGGG - Intergenic
1176812117 21:13552514-13552536 TATTTTTAAATATTTTAGGGTGG + Intergenic
1177086681 21:16713511-16713533 TGCTTTTATACTTTTTAGAGTGG - Intergenic
1177156603 21:17507195-17507217 TGGTTTTATGCATTTTAGGGAGG - Intergenic
1177175964 21:17700981-17701003 TGGTTTTATGCATTTTAGGGAGG + Intergenic
1177255866 21:18662263-18662285 TGGTTTTATACATTTTAGGGAGG - Intergenic
1177271282 21:18851780-18851802 TGGTTTTATAAATTTTAGGGAGG + Intergenic
1177385907 21:20409152-20409174 TTATTTTGTACATTTTAGGGAGG - Intergenic
1177435634 21:21048689-21048711 TGGTTGTATATATTTTAGGGAGG - Intronic
1177508098 21:22043739-22043761 TGGATTGACACATTTTAAGCAGG - Intergenic
1177887436 21:26763162-26763184 TGGTTTTATACATTTTAGGGAGG - Intergenic
1178031687 21:28534937-28534959 TGGTTTTGTATATTTTAGGGAGG + Intergenic
1178179664 21:30145264-30145286 TGGTTTTACACATTTTAGGGAGG - Intergenic
1178386291 21:32153306-32153328 TGGTTTTATGTATTTTAGAGAGG + Intergenic
1178386894 21:32159653-32159675 TGGTTTTATGTATTTTAGGAAGG + Intergenic
1178386986 21:32160509-32160531 TGGTTTTATACATTTTAGGGAGG + Intergenic
1178866312 21:36330513-36330535 TGGTTTTATATATTTTAGGGTGG - Intronic
1179259998 21:39749620-39749642 TGGTTTTATACATTTTGTGGAGG + Intronic
1179448827 21:41453693-41453715 TGATTTTATACATTTCAGAGAGG + Intronic
1179460494 21:41531488-41531510 TGGTTTTATACATTTTAGGGAGG + Intergenic
1179619388 21:42602789-42602811 TGTTTTTATATATTTTAGGGAGG + Intergenic
1179622255 21:42624948-42624970 TGGCTTTATACATTTTAGAGAGG - Intergenic
1179649507 21:42798335-42798357 TGGCTTTATATATTTTAGGGAGG + Intergenic
1179761281 21:43531155-43531177 TGGCTTTATACATTTTAGAGAGG - Intronic
1179807823 21:43851244-43851266 TGGTTTTATACATTTTAGGGAGG - Intergenic
1179892422 21:44343197-44343219 TGGTTTTTTACTTTTTAGGAAGG + Intergenic
1179915071 21:44471825-44471847 TGGATTTGTAGATTTTAGGGAGG - Intergenic
1180135044 21:45856796-45856818 TGGTTTTATTCACTTTAGGGAGG + Intronic
1180178766 21:46107855-46107877 CGGTTTTATTCATTTTAGGGAGG - Intronic
1180578498 22:16804832-16804854 TGGTTTTATACATTTTAGGGAGG - Intronic
1182521347 22:30886162-30886184 TGGTTTTATATATTTTAGGGAGG + Intronic
1183077815 22:35437891-35437913 TATTTTTTCACATTTTAGTGAGG + Intergenic
1183253996 22:36749010-36749032 TAGTTGTACATATTTTGGGGGGG + Intergenic
1183636180 22:39064239-39064261 TGGTTTTATATATTTTAGAGAGG + Intronic
1183637471 22:39073132-39073154 TGGTTTTATACATTTTAGAGGGG + Intronic
1184042101 22:41950391-41950413 TGCTTTTTAACATTTTGGGGTGG - Intergenic
1184578730 22:45397668-45397690 TTGTTGTACCCACTTTAGGGTGG + Intronic
949327821 3:2886940-2886962 TGGTTCTACACATATAAGGTTGG - Intronic
949439990 3:4070228-4070250 TGGTTTTATGTATTTTAGGGAGG - Intronic
949611820 3:5710635-5710657 TGATTTTACATATTTTAGGAAGG + Intergenic
950537485 3:13587945-13587967 TGGTTTTGTACATTTTAGGGAGG - Intronic
951048818 3:18071537-18071559 TGTTTTTAGCCATTTTAGGAAGG + Intronic
951138272 3:19130019-19130041 TGGTTTTATACATTTTAGGGAGG - Intergenic
951285538 3:20808587-20808609 TAATTATACACATTTTATGGAGG + Intergenic
951300101 3:20986199-20986221 TGCTTTTACATATTTTAGGGAGG + Intergenic
952107385 3:30085967-30085989 TGGTTTTATACATGTTAGGGAGG - Intergenic
952455007 3:33464664-33464686 TGGTTTTACACATTTTAGGGAGG - Intergenic
953427365 3:42805818-42805840 TGGTTTTATACATTTTAGAGAGG + Intronic
954119914 3:48491460-48491482 TGGTTTCATACATTTTAGAGAGG - Intronic
955516316 3:59729840-59729862 TGGTTGTATACATTTTAGGGAGG - Intergenic
956708724 3:72021974-72021996 TGGTTTTATACATTTTAGGGAGG - Intergenic
956986560 3:74708180-74708202 TTGGTTTATACATTTTAAGGGGG - Intergenic
957238463 3:77625735-77625757 TGGTTTTTCACATTTTTGAAAGG + Intronic
957297658 3:78353661-78353683 TGGTTTCATACATTTTAGCGAGG - Intergenic
957440649 3:80242462-80242484 TGCATTTATACATTTTGGGGAGG - Intergenic
957465230 3:80581220-80581242 TGGTTTTATACATTTTAAAGAGG + Intergenic
957669929 3:83288311-83288333 TGGTTTTATGCGTTTTAGGGAGG - Intergenic
957839437 3:85648553-85648575 TGATTTTAAACATTTAAGAGAGG - Intronic
958064282 3:88522958-88522980 TGGTTTTGGACATTTTTTGGGGG + Intergenic
958102138 3:89026456-89026478 TAGTTTTACACATTTGAGTGTGG - Intergenic
958525352 3:95251706-95251728 TGCTTTTATACATTTTAGGGAGG + Intergenic
958566443 3:95817246-95817268 TGGCTTTTTACATTTTAGAGAGG - Intergenic
959062709 3:101630622-101630644 TGGTTTTTTACATTTTAGAGAGG - Intergenic
959296822 3:104545896-104545918 TGGTTTTATACATTTTAGGGAGG - Intergenic
959405967 3:105962094-105962116 TGGTTTTATATATTTTAGGGAGG - Intergenic
960158570 3:114323544-114323566 TGCTTGTGCACATTTTAGTGTGG - Intergenic
960208093 3:114927334-114927356 TGGTTTTATACATTTTAGGGAGG - Intronic
960723812 3:120650311-120650333 TGGTTTTATACATTTTAGGGAGG - Intronic
961164163 3:124751996-124752018 TGGTTTTATACATTTTAGACAGG - Intergenic
961794323 3:129398741-129398763 TGGTTTTGTACATTTTAGGGAGG - Intergenic
962094751 3:132281785-132281807 TGGTTTTATACATTTTAGGCGGG - Intronic
962566937 3:136670460-136670482 TGGTTTTATACCTTTTTTGGGGG + Intronic
963353597 3:144182300-144182322 TGGTTTTATATATTTTAGGGAGG - Intergenic
963412750 3:144952756-144952778 TGGTTTTATACATTTTAGGGAGG + Intergenic
963502629 3:146147315-146147337 TGCTTTTACACATCTTTTGGAGG - Intronic
963550071 3:146709138-146709160 TGTTCTTAAACATTTTAGGAAGG - Intergenic
963669304 3:148231759-148231781 TGGTTTTATACATTTTAGAGAGG + Intergenic
964376737 3:156055408-156055430 TAGATATACACATTTTAGGCCGG + Intronic
964394560 3:156231880-156231902 TGGTTTTATACATTTTAGGAAGG - Intronic
964458721 3:156897441-156897463 TGGTTTTATACATTTTAGGGAGG + Intronic
964845611 3:161041330-161041352 TGGTTTTAAACCTTTTAGGGAGG - Intronic
964999525 3:162935545-162935567 TGGTTTTATAGATTTTAGGGAGG - Intergenic
965091615 3:164170270-164170292 TGCTTTTATACATTTTAGGGAGG + Intergenic
965398199 3:168186238-168186260 TAAATATACACATTTTAGGGTGG - Intergenic
965616254 3:170595817-170595839 TGGTTTCACACCATTTAGGATGG - Intronic
966131930 3:176651185-176651207 CGGTTTTACACAGTTTAGGAAGG + Intergenic
966537565 3:181051522-181051544 TGGTTTTATATATTTTAGGGAGG + Intergenic
966952473 3:184834330-184834352 GGGTTTAATACATTTTAAGGTGG + Intronic
967162929 3:186755298-186755320 TGGCTTTATACATTTTAGGGAGG - Intergenic
967636351 3:191806525-191806547 TGGTTTTATATATTTTAGGGAGG - Intergenic
967755422 3:193163086-193163108 TGGTTTTGTATATTTTAGGGAGG - Intergenic
967886946 3:194339874-194339896 TGGTTTTATACATTTTAGGGAGG + Exonic
968191307 3:196669619-196669641 TGGTTTTATACATTTTAGAGAGG + Intronic
969079164 4:4604982-4605004 TGGTTTTATCCATTTTAGAGAGG - Intergenic
969186764 4:5480352-5480374 TGGTTTTAAACATTTTAGGGAGG + Intronic
969199006 4:5586821-5586843 TGATTTTATACATTTTCGGGAGG - Intronic
969653374 4:8481325-8481347 TGGTTTTATGTATTTTAGGGAGG - Intronic
970237303 4:13971831-13971853 TAGTTTTATACCTTTTAGGAAGG + Intergenic
970711654 4:18870746-18870768 TGGTTTTACACATTTTAGCGAGG - Intergenic
970878783 4:20903667-20903689 TGGTTTTATACATTTTAGAGAGG - Intronic
971019806 4:22523186-22523208 TGGTTTTACACATTTTAAGCAGG + Intergenic
971076410 4:23154104-23154126 TGATTTTACACACTTTAGGGAGG - Intergenic
971117295 4:23663511-23663533 TGGTTTTATACATTTTAGGGAGG + Intergenic
971333305 4:25700318-25700340 TGGTTTTATATATTTTAGGGAGG - Intergenic
971447192 4:26763587-26763609 TGGTTTTATACATTTTAGGGAGG - Intergenic
971955152 4:33407901-33407923 TGGTTTTATACATTTTAGAGAGG - Intergenic
971998053 4:33992977-33992999 TGGTTTTATACATTTTAGGGAGG + Intergenic
972045481 4:34660424-34660446 TGTTTATACACATTGTAGGATGG + Intergenic
972566293 4:40272340-40272362 TGGTTTTATGCATTTTAGGGAGG - Intergenic
972827918 4:42782902-42782924 TGGTTTTATACATTTCTGTGGGG + Intergenic
972912311 4:43832534-43832556 TGGTTTTATACATTTTAGAGAGG - Intergenic
972916223 4:43883331-43883353 TGGTTTTATACATTTTAGGGAGG + Intergenic
973245954 4:48011647-48011669 TGGTTTTACACGTTTTAGAGAGG + Intronic
973336920 4:48965995-48966017 TGGCTTGATACATTTTAGGGAGG - Intergenic
973574204 4:52269671-52269693 TGGTTTTACACATTTTAGGGAGG - Intergenic
973692224 4:53448035-53448057 AAGTCTTACACATTTTAGTGGGG + Intronic
974460080 4:62176035-62176057 TGGTTTTATATATTTTAGGGAGG + Intergenic
974514319 4:62888862-62888884 TTTTGTTACACATTTGAGGGAGG - Intergenic
974627051 4:64439494-64439516 TGGTTTTATATATTTTAGGGAGG + Intergenic
974627755 4:64445615-64445637 TGGTTTCATATATTTTGGGGAGG + Intergenic
974923052 4:68265954-68265976 TGGTTTCATACATTTTAGGGAGG + Intergenic
975240592 4:72053038-72053060 TGGTTTTATATATTTTAGGGAGG - Intronic
975251000 4:72177414-72177436 TGGTTTTATATAATTTAGGGAGG - Intergenic
975947779 4:79728489-79728511 TGGTTTTATATATTTTGGGGAGG - Intergenic
976065390 4:81181986-81182008 TGGGTTTAGACTTTTTTGGGTGG - Intronic
976355707 4:84115015-84115037 TGGTTTTATGATTTTTAGGGTGG + Intergenic
976970759 4:91099570-91099592 TGGTTTTTTACATTTTAGAGAGG + Intronic
977343487 4:95790056-95790078 TGGTTTTATACGTTTTAGGAAGG + Intergenic
977480757 4:97571716-97571738 TGGTTTGATACATTTTAGGGAGG - Intronic
977486298 4:97650402-97650424 TGGTTTTATACATTTTAGGGAGG + Intronic
977992890 4:103466101-103466123 TGATTTTATACATTTTAGGGAGG + Intergenic
978037914 4:104019431-104019453 GGATTTTACACAATTTTGGGGGG + Intergenic
978337429 4:107684785-107684807 TGGTTTTATACATTTTAGAGAGG - Intronic
979239964 4:118439285-118439307 TGGTTTTATGCATTTTAGAAAGG + Intergenic
979770814 4:124522982-124523004 TGTTTTTATACATTTTAGGGAGG - Intergenic
980052792 4:128054907-128054929 TGATTTTATGCATTTTAGGGAGG + Intergenic
980300314 4:130982755-130982777 TGGTTTTACAAATCTCAAGGTGG + Intergenic
980375949 4:131949463-131949485 TGCTTTTATACATTTTAGAGAGG + Intergenic
980983061 4:139670406-139670428 TGGTTTTATACATTTTAAGGAGG + Intronic
981170742 4:141620475-141620497 TGATTTTATACATTTTGGGGAGG + Intergenic
981252057 4:142615242-142615264 TGGTTTTATACATTTTAGAAAGG + Intronic
981252061 4:142615269-142615291 AGGTTTTATACATTTTAGAAAGG + Intronic
981314421 4:143327974-143327996 TGGTTTTACATATTTTAGGGAGG + Intergenic
981477296 4:145199678-145199700 TGATTTTATACATTTTAGGGAGG + Intergenic
982312394 4:153999773-153999795 TGGTTCTCCTCATTTTAGGCAGG - Intergenic
982915253 4:161201298-161201320 TGGTTTTATACATTTTAGAGAGG + Intergenic
982938996 4:161524340-161524362 TGGTTTTTTACATTCTAGGGAGG - Intronic
983141318 4:164152967-164152989 TGATTTTATATATTTTAGGAAGG - Intronic
983189852 4:164743723-164743745 TATTTTAATACATTTTAGGGCGG - Intergenic
983343319 4:166494481-166494503 TGGTTTTATACATGTTAGGGAGG - Intergenic
983495518 4:168438332-168438354 TGGTTTTATATATTTCAGGGAGG - Intronic
983710803 4:170713278-170713300 TGGTTTTATACAATTTAGAGAGG - Intergenic
983822749 4:172216817-172216839 TGGTTTTATACAGTTTAAGGAGG + Intronic
984013414 4:174399186-174399208 TGGTTTTATACATTTTAGGGAGG + Intergenic
984049112 4:174841883-174841905 TGGTTTTATAAATTTTAAGAAGG + Intronic
984073817 4:175150381-175150403 TGGTTTTATACATTTTAGGCAGG - Intergenic
984166100 4:176304768-176304790 TGGTTTTATACATTTTAGGGAGG - Intergenic
984364493 4:178781120-178781142 TGGTTTTATATATTTTAGGGAGG + Intergenic
984393292 4:179166282-179166304 TGGCTTTATATATTTTAGGGAGG - Intergenic
984438007 4:179728234-179728256 TGGTTATACGCATTTTAGGGAGG + Intergenic
984606124 4:181787831-181787853 AGGTTTTACACATTTTAAGAAGG - Intergenic
985103919 4:186483664-186483686 TGGTCTTACACATTTTGAGAAGG - Intronic
986354431 5:6909826-6909848 TGGTTTTACACTTTTTAGGGAGG - Intergenic
986429204 5:7665066-7665088 TGGGTTTATATATTTTAGGGAGG - Intronic
986575086 5:9204226-9204248 TTGTTTTCCACATTTTAGGAAGG - Intronic
986646920 5:9925835-9925857 TGGTTTTATACATTTTAGGGAGG - Intergenic
986781116 5:11066558-11066580 TGGTTTTATACAGTTTAGAGAGG - Intronic
987356604 5:17068869-17068891 TGGTTTTATCCATTCTAGGGAGG - Intronic
987462887 5:18235048-18235070 TGGTTTTATACATTTTAGATAGG + Intergenic
987679509 5:21117190-21117212 TGGTTTTACACATTTTAGGGAGG + Intergenic
987719774 5:21618370-21618392 TGGTTTTATACATTTAAGGGAGG - Intergenic
987720755 5:21629094-21629116 TGGTTTTATACATTTTAGGGAGG - Intergenic
987757343 5:22113595-22113617 TGGTTTTATACATTTTAGGGAGG - Intronic
987786641 5:22508835-22508857 TGGTTTTATACATTTCAGGGAGG - Intronic
987871724 5:23627685-23627707 TAGATTTATACATTTCAGGGAGG - Intergenic
988016592 5:25567543-25567565 TGGTTTTATATATTTTAGAGAGG - Intergenic
988262461 5:28905928-28905950 TGGTTTTAAATATTTTATAGTGG - Intergenic
988314076 5:29601462-29601484 TGGTTTTAAATATTTTAGGAAGG - Intergenic
988365615 5:30294688-30294710 TGGTTTTATATATTTTAGGGAGG - Intergenic
988568040 5:32336139-32336161 TGGTTTCATACATTTTAGGGAGG + Intergenic
988633186 5:32952855-32952877 TGGTTTTATGCATTTTGGAGAGG - Intergenic
988801663 5:34701667-34701689 TGGTTTTATACATTTTAGAGAGG - Intronic
989349221 5:40465866-40465888 TGATTTTATACATTTTAGAGGGG - Intergenic
989541623 5:42625557-42625579 TGGTTTTATATATTTTAGGGAGG + Intronic
989830179 5:45907155-45907177 TGGTTTTATATATTTTAGGTAGG + Intergenic
989977606 5:50605039-50605061 TATTTTTACACATTATAGAGTGG - Intergenic
990006983 5:50955139-50955161 TGGTTTAATACATTTTAGGGAGG - Intergenic
990184437 5:53198639-53198661 TGATTTTATATATTTTAGGGAGG + Intergenic
990186228 5:53212727-53212749 TGGTTTTCTATATTTTAGGGAGG + Intergenic
990307590 5:54508092-54508114 TGGTTTTACACATTTTAGAGAGG + Intergenic
990741126 5:58913885-58913907 TGGTTTTATATATTTTAGAGAGG - Intergenic
991061005 5:62376057-62376079 TGGTTTTCCACATCTTTGGGAGG - Intronic
991234625 5:64379329-64379351 TGGTTTTATGTATTTTAGGGAGG - Intergenic
991424770 5:66479152-66479174 TGGGTTTATACATTTTAGGGTGG - Intergenic
992583699 5:78209576-78209598 TGCTTTTATACATTTTAGGGAGG - Intronic
992721889 5:79569193-79569215 TGGTTTTATGTATTTCAGGGAGG + Intergenic
992856114 5:80863324-80863346 TGGTTTTATATATTTTAGGGAGG + Intronic
993733039 5:91445344-91445366 TGGTTTTATGCAATTTAGGGAGG - Intergenic
993965437 5:94354931-94354953 TGTTTTTATATATTTTAGGGAGG + Intronic
994641262 5:102412246-102412268 TTGTATTATACATTTTAGGGAGG - Intronic
994874436 5:105398676-105398698 TGGTTTCAGACACTTTAGGAGGG + Intergenic
994981785 5:106884641-106884663 TGAATTTCCACATTTTGGGGTGG - Intergenic
995128953 5:108609554-108609576 TGGTTTTACACATTTTAGGGAGG - Intergenic
995152214 5:108862058-108862080 TGTTTTGACAGATTTTGGGGAGG - Intronic
995566553 5:113436968-113436990 TGGTTTTATACATTTTAGGGAGG - Intronic
995663312 5:114510675-114510697 TGGTTTTATATATTTTAGGGAGG - Intergenic
995676223 5:114665337-114665359 TGGATTTAAACATTTTGGGTGGG + Intergenic
995741300 5:115358679-115358701 TGGTTTTATACATTTTAGAGAGG - Intergenic
995801175 5:115997175-115997197 TTGTTTTACCCATTTTCGGACGG + Intronic
996123976 5:119704772-119704794 TGGTTTTACATATTTTAGAGAGG - Intergenic
996380675 5:122859756-122859778 TGGCTTTATACATTTCAGAGTGG + Intronic
996478345 5:123946553-123946575 TGGTTTTATACATTTTAGGGAGG - Intergenic
996487949 5:124058666-124058688 TGGTTTGACACAGATTTGGGGGG + Intergenic
996530118 5:124519712-124519734 AAGTTTTACACCTTTTAAGGGGG - Intergenic
996964715 5:129294259-129294281 TGGTTTTATGTATTTTAGGGAGG + Intergenic
997158598 5:131583672-131583694 TGGTTTTATATATTTCAGGGAGG - Intronic
997425022 5:133797160-133797182 TGGTTTTATACATTTTAGGGAGG + Intergenic
998066822 5:139165998-139166020 TGGTTTTATATATTTCAGGGAGG - Intronic
998646033 5:144063442-144063464 TGGTTTTATACATTTTGGGAGGG + Intergenic
998727267 5:145031873-145031895 TGGTATTACACATTTTAGGGAGG - Intergenic
999801806 5:155045426-155045448 TGATTTTATACATTTTAGGGGGG - Intergenic
999802607 5:155051881-155051903 TGGTTTTATACACTTTAGATAGG - Intergenic
999819347 5:155209923-155209945 TGGTTTTATATATTTTGGGGAGG + Intergenic
1000168134 5:158675074-158675096 AGGTTTTATAAATATTAGGGTGG + Intergenic
1000363790 5:160472482-160472504 TGATTTCATACATTTTAGAGAGG + Intergenic
1001466924 5:171975643-171975665 TTGTTTTCCACATTTTAGCATGG - Intronic
1002740218 5:181429870-181429892 TGGTTTTATGCATTTTAGAAAGG + Intergenic
1003195156 6:3907839-3907861 TGGTTTTATGTATTTTAGGAAGG - Intergenic
1003202391 6:3973894-3973916 TGGTTTTACACATTTTAGGGAGG - Intergenic
1003231838 6:4261015-4261037 TGGTTTTACATATTTTTGGGAGG - Intergenic
1003475487 6:6478296-6478318 TGGTTTTATAGATTTTAGGGAGG - Intergenic
1003784483 6:9469234-9469256 TGGTTTTCAAAATTTTAGAGTGG + Intergenic
1003800439 6:9659043-9659065 TTATTTTACACATTTTAAAGAGG + Intronic
1004866283 6:19856532-19856554 TGGTTTTGTACAATATAGGGAGG + Intergenic
1005285547 6:24322820-24322842 TGGTTTTATATATCTTAGGAAGG - Intronic
1005331827 6:24758070-24758092 TGGTTTTATACATTTCAGGGAGG + Intergenic
1005449202 6:25956576-25956598 TGGCTTTATACATTTTAGGGAGG + Intergenic
1005491860 6:26354502-26354524 AGGTTTTATAGAGTTTAGGGAGG + Intergenic
1005652831 6:27900304-27900326 TGGTTTTATACATTTTAGGGAGG - Intergenic
1005684085 6:28235171-28235193 TGGTTTTATATATTTTAGGGAGG + Intergenic
1006413671 6:33890932-33890954 TGGTTTTATATGTTTTAGGAAGG - Intergenic
1006817052 6:36858725-36858747 GAGTTTTACACAGTTTAGTGTGG - Intronic
1007012859 6:38434528-38434550 GTTTTTTATACATTTTAGGGAGG - Intronic
1007311450 6:40949503-40949525 TGGTTTTATACATTTGAGGGAGG - Intergenic
1008218727 6:48827787-48827809 CGGTTTTATACATTTTGGAGAGG + Intergenic
1009750805 6:67877285-67877307 TGGTTATGTACACTTTAGGGAGG + Intergenic
1010010701 6:71044613-71044635 TGGTCTGGCACATTTTAGGTGGG - Intergenic
1010383280 6:75248574-75248596 TGGTTTTATATATTTTTGGGAGG - Intronic
1010433968 6:75809538-75809560 TGGTTTTATACATTTTAGGAAGG + Intronic
1010452796 6:76021329-76021351 TGGTTTCATACGTTTTAGGGAGG - Intronic
1011121294 6:83956273-83956295 TGGTTTGATACATTTTAGGGAGG + Intronic
1011363441 6:86552868-86552890 TGGTTTGATACATTTTAGGGAGG - Intergenic
1011559895 6:88603634-88603656 TGGTTTTATATATTTTAGAGAGG - Intergenic
1011644211 6:89442304-89442326 TGGTTTTATACATTTGAGGGAGG + Intronic
1012118093 6:95330329-95330351 TGGTTTTATATGTTTTAGGAAGG + Intergenic
1012523791 6:100152834-100152856 TTGTTTTACAAATTTTAGGAAGG - Intergenic
1012634037 6:101513130-101513152 TGGTTTTATACACTTCAGAGAGG + Intronic
1012650161 6:101742524-101742546 TGGTTTTATACATTTTAAGGAGG + Intronic
1013237151 6:108207195-108207217 TGTTTCTCCAGATTTTAGGGTGG + Intergenic
1013412683 6:109895821-109895843 TGGTTTTATACATGTTAGGGAGG + Intergenic
1014242772 6:119035876-119035898 TGGTTTTATACATTTTAGGGTGG - Intronic
1014442945 6:121494314-121494336 TGGTTTTATACATTTTAGAGAGG - Intergenic
1014629473 6:123771530-123771552 TGGTTTTGTACATTTCAGGGAGG - Intergenic
1014816319 6:125939577-125939599 TGGTTTTATATATTTTAGGAAGG - Intergenic
1014931139 6:127337565-127337587 TGGTTTTACATATTTTAGGAAGG - Intronic
1015315568 6:131812709-131812731 TGTTTTTATATATTTCAGGGAGG + Intronic
1015681742 6:135816022-135816044 TGGTTTTATATATTTTAGGAAGG + Intergenic
1015814342 6:137192626-137192648 TGCTTTTATACTTTTTAGGGAGG + Intergenic
1016547241 6:145238159-145238181 TGGTTTTATGTATTTTAGGAAGG - Intergenic
1016602458 6:145877950-145877972 TGGTTTTATATATTTTAGAGAGG - Intronic
1016709993 6:147159402-147159424 CGGTTTATCACATTTTTGGGGGG - Intergenic
1016788279 6:148037335-148037357 TGCTTTTAGTCTTTTTAGGGAGG - Intergenic
1016854273 6:148650805-148650827 TGGTTTTATACATTTTAGGGAGG + Intergenic
1017072432 6:150587592-150587614 TGGTTTTAGACATTTTGAGGAGG + Intergenic
1017349092 6:153418764-153418786 TGGTTTTATGTACTTTAGGGAGG + Intergenic
1017868480 6:158465723-158465745 TGGTTTTGTACATTTCAGGGAGG + Intronic
1018076113 6:160215084-160215106 TGGTTTTATACATTTTAGAGAGG - Intronic
1018190027 6:161302496-161302518 TGGTTTTATACATTATAAGGAGG - Intergenic
1018260469 6:161965640-161965662 TGGTTTTATACATGTTAAGGAGG + Intronic
1018835796 6:167482741-167482763 TGGTTTTATGCAATTTAGAGAGG + Intergenic
1018890599 6:167978710-167978732 TGGTTTTATACAATTTAGAGAGG + Intergenic
1018992025 6:168681529-168681551 TGGTTTTACACATTCTGGTTGGG - Intergenic
1018992032 6:168681568-168681590 TGGTTTTATACATTTTGGTTGGG - Intergenic
1018992203 6:168682790-168682812 TGGTTTTATGCAATTTAGAGAGG - Intergenic
1019106922 6:169675547-169675569 TGGTTTTATGTACTTTAGGGAGG + Intronic
1019245331 6:170705470-170705492 TGGTTTTATGCATTTTAGAAAGG + Intergenic
1019295999 7:275717-275739 TGGTTTTATACATTTTGGGGAGG - Intergenic
1020641437 7:10759000-10759022 TGTTTTTATACATTTTTGGAAGG - Intergenic
1020985363 7:15127135-15127157 TGGTTTAATATATTTTAGGGAGG - Intergenic
1021015533 7:15526532-15526554 TGGTTTTATAAATTTTAGGGAGG - Intronic
1021102056 7:16595530-16595552 TGGTTTTATTTATTTTAGAGAGG + Intergenic
1021645886 7:22789148-22789170 TGGTTTTATATATTTTAGGGAGG + Intergenic
1021687900 7:23205388-23205410 TGATAATACACAATTTAGGGTGG - Intergenic
1022004600 7:26255792-26255814 TGGTTTTATACATTTCAAGGAGG + Intergenic
1023293488 7:38691431-38691453 TGGTTTTATACATTTTAGGGAGG + Intergenic
1023667552 7:42540606-42540628 TGGTTTTCTACATTTTAGGGAGG + Intergenic
1025005356 7:55350033-55350055 TGGTTTTATGTATTTTAGGAAGG - Intergenic
1025109006 7:56196995-56197017 TGGTTTTACACATTTTAAGGAGG - Intergenic
1025523103 7:61766254-61766276 TGATTTTACACATTCTGCGGAGG - Intergenic
1026143149 7:67723347-67723369 TGGTTTTATACATTTTAGGGAGG - Intergenic
1026209357 7:68289731-68289753 TGGTTTTATACATTTTTAGGAGG - Intergenic
1026274789 7:68867172-68867194 TGGTTTTATACATTTTAGGGAGG - Intergenic
1026496629 7:70909164-70909186 TGGTTTTATACATTTTAGGGAGG + Intergenic
1026502990 7:70958769-70958791 TGGTTTTATATATGTTAGGGAGG - Intergenic
1026562249 7:71460063-71460085 TGGCTTTATATATTTTAGGGAGG - Intronic
1026607603 7:71829067-71829089 TGGTTTTATACACTTTAGGGAGG - Intronic
1026661491 7:72306771-72306793 TAGTTTTATACATATTAGGGAGG - Intronic
1026871465 7:73855352-73855374 TGTTTTTAAATATTTTAGAGAGG - Intergenic
1027517170 7:79156676-79156698 TGGTTTTATACATTTTAGGGAGG - Intronic
1027517858 7:79164782-79164804 TTGTTTTATACATTTTAGGGAGG - Intronic
1027601564 7:80246638-80246660 TGGTTTTATCCATCTTAGGGAGG + Intergenic
1028205614 7:88013226-88013248 TGTTTTTCCAGATTTTGGGGTGG + Intronic
1029332276 7:99868760-99868782 TGGTTTTATACATTTTAGAGAGG - Intergenic
1029379992 7:100207180-100207202 TGCATGTACACATTTTTGGGTGG + Intronic
1030118109 7:106079143-106079165 TTGTTTTATATGTTTTAGGGAGG - Intergenic
1030396292 7:108990731-108990753 TGGTTTTATGTATTTTAGGAAGG + Intergenic
1031227115 7:119053628-119053650 TGGTTTTATACATTTGAGGGAGG + Intergenic
1031227195 7:119054628-119054650 TGGTTTTTTACATTTTAGGGAGG + Intergenic
1032358097 7:131229005-131229027 TGGTTTTATACATTTTGGAGAGG + Intronic
1032420346 7:131774351-131774373 TTGTTTTATACATTTTAGAGAGG - Intergenic
1032607393 7:133370318-133370340 TTATTTTATACATTTTAGGGAGG + Intronic
1032612130 7:133425968-133425990 TGGTTTTACACATTTCAGGGAGG - Intronic
1034051397 7:147987994-147988016 AGGTTTTATACATTTTAGAGAGG + Intronic
1034519146 7:151605353-151605375 TGGTTTTACACATTCAAAGAGGG - Intronic
1035131721 7:156660832-156660854 TGGTTTCATACATTTTAGGGAGG + Intronic
1035209294 7:157316013-157316035 TGGTTTTATAGATTTTAGGGAGG - Intergenic
1035217145 7:157376573-157376595 TTGGTTTATACATTATAGGGAGG + Intronic
1035346306 7:158201866-158201888 TGGTTTTATAGATTTTAGGGAGG - Intronic
1035359865 7:158304356-158304378 TGGATTTCTACATTCTAGGGAGG + Intronic
1035359878 7:158304480-158304502 TGGATTTCTACATTCTAGGGAGG + Intronic
1035496116 7:159327995-159328017 TGGTGTTCCACATTTCAGTGAGG - Intergenic
1035502796 8:102732-102754 TGGTTTTATGCATTTTAGAAAGG - Intergenic
1035556469 8:570764-570786 TGGTTTTATACATTTTAGAGAGG - Intergenic
1036052257 8:5212761-5212783 TGATTTCATACAATTTAGGGAGG + Intergenic
1036637661 8:10563150-10563172 TGGTTTTATATATTTTAGGGAGG - Intergenic
1037142655 8:15537390-15537412 TGGTTTTATATATTTTAGAGAGG - Intronic
1037420504 8:18696863-18696885 TCTTTTTACACATTTTAATGAGG - Intronic
1038739110 8:30201144-30201166 TGGTTTTATACATTTTAGGAAGG - Intergenic
1038829708 8:31043453-31043475 TGCTGTTACACATTTTGGGATGG + Intronic
1038988551 8:32840620-32840642 TGGTTTTATACATTTTAGAGAGG + Intergenic
1039084657 8:33767864-33767886 TGGTTTAATACAGTGTAGGGAGG - Intergenic
1039354339 8:36798810-36798832 TGGTTTTACACATTTTAGGGAGG - Intronic
1039509079 8:38076337-38076359 TGGTTTCATACATTGTAGGGAGG + Intergenic
1039757414 8:40538416-40538438 GTTTTATACACATTTTAGGGAGG - Intronic
1039813671 8:41072899-41072921 TGGTTTCATACATTTTAGGGAGG + Intergenic
1039814554 8:41081542-41081564 TGGTCTTACACATTTTAGAGAGG + Intergenic
1040055633 8:43055144-43055166 GGGTTTTATACATTTTCGGGAGG + Intronic
1040402057 8:47061223-47061245 TGGTTTTATACATTTTAGAGAGG - Intergenic
1040664632 8:49618422-49618444 GGGTTTTATATATTTTGGGGAGG - Intergenic
1040717558 8:50275819-50275841 TGTCTTTTCAGATTTTAGGGTGG + Intronic
1041105690 8:54441652-54441674 TGGTTTTACACATGTAAAGAGGG - Intergenic
1041317687 8:56581605-56581627 TTGTTTTACACATTTTAGAGAGG - Intergenic
1041359708 8:57040378-57040400 TGGTTTTCTCCATTTTAGGGAGG + Intergenic
1041406103 8:57501123-57501145 TGGTTTTATACATTTTAGGGAGG + Intergenic
1041609366 8:59826668-59826690 TGTTTTTATATATTTTAGGAAGG - Intergenic
1041767524 8:61434504-61434526 TAGTTTTATATATTTTAGGGAGG + Intronic
1041813359 8:61937728-61937750 TGATTTTATAGATTTTAGGGAGG - Intergenic
1042053639 8:64738751-64738773 TGGTTCTCCAGATTTTGGGGTGG - Intronic
1043535328 8:81196912-81196934 TTGTTATACACATTTTAGGCAGG - Intergenic
1043596730 8:81896338-81896360 TGATTTCACACATTTTAGAGAGG - Intergenic
1043718454 8:83512826-83512848 TGGTTTTATACATTTTAGGGAGG + Intergenic
1044031457 8:87242653-87242675 TGGTGTTATACATTTTAAGGAGG - Intronic
1044645564 8:94439587-94439609 TACTTTTATATATTTTAGGGAGG + Intronic
1045556759 8:103221924-103221946 TGGTTTTATATATTTTAGGGAGG + Intronic
1045556997 8:103224324-103224346 TGGTTTTATATATTTTAGGGAGG + Intronic
1045680576 8:104655396-104655418 TGGTTTTATACAGCTTAGGGAGG - Intronic
1046111815 8:109734626-109734648 TGGTTCTACATTTTTTAAGGTGG - Intergenic
1046222878 8:111238317-111238339 TGGTTTTACACAATTAGGGAAGG + Intergenic
1046911454 8:119631909-119631931 TGATTTTAAACATCTTAGGCTGG - Intronic
1047114266 8:121823186-121823208 TGATTTTATATATTTCAGGGAGG + Intergenic
1047371527 8:124259942-124259964 TGGATTTATAAATTCTAGGGGGG + Intergenic
1047627858 8:126675229-126675251 AGGTTTTAAATATTTTAAGGTGG - Intergenic
1048655981 8:136536352-136536374 TGGTTTTAGACATTTTAGGGAGG - Intergenic
1048891800 8:138954971-138954993 TGGTTTTATACATTTTAGGAAGG - Intergenic
1049461860 8:142733800-142733822 TGCTTTTATACATCTCAGGGAGG + Intronic
1049964383 9:765298-765320 TGGTTTTATACATTTCAGGGAGG - Intergenic
1050060741 9:1707140-1707162 TAGTTTTATATATTTTAGGAAGG - Intergenic
1050118337 9:2283113-2283135 TGGTTTTATACATTTTAGGGAGG + Intergenic
1050455024 9:5826288-5826310 TGGGTTTACACATTTGAAGCAGG + Intronic
1050673183 9:8021045-8021067 TGCTTTTACACATTTTAATCAGG - Intergenic
1050707672 9:8421703-8421725 TGCTTTTAAACATTTGATGGAGG - Intronic
1050740048 9:8809506-8809528 GAGTTTTACAGATTTCAGGGAGG - Intronic
1050952521 9:11616050-11616072 TGGTTTCATACATTTTAGGAAGG + Intergenic
1050984440 9:12064323-12064345 TGGTTTTGTATATTTTAGGAAGG + Intergenic
1051271002 9:15354729-15354751 TGGTTTTATACATTTTAGGGAGG + Intergenic
1051506495 9:17832583-17832605 TGGTTTTATACATTTTAGGAAGG - Intergenic
1052108913 9:24555066-24555088 TGGATTTACAAATTTTACTGGGG - Intergenic
1052121963 9:24729327-24729349 TGGTTTTACATATTTTAGGGAGG - Intergenic
1052176970 9:25473903-25473925 TGGTTTTATACATTTTAGGGAGG - Intergenic
1052183542 9:25562009-25562031 TGGTTTTATACATTTTAGGGAGG + Intergenic
1052506830 9:29366092-29366114 TGTTTTGATACATTTTATGGAGG + Intergenic
1052560345 9:30076995-30077017 TAGTTTTACCCATTTTAGACAGG - Intergenic
1053044758 9:34906265-34906287 TGGTTTTATACATTTTAGGGAGG + Intergenic
1053078823 9:35157290-35157312 TGGTTTTATAAATTTTTGGGAGG - Intergenic
1053539983 9:38963585-38963607 TGGTTTTATACATTTCAGGGAGG + Intergenic
1053640998 9:40080130-40080152 TGCTTTTATACATTTTAGAGAGG + Intergenic
1053765138 9:41385338-41385360 TGCTTTTATACATTTTAGAGAGG - Intergenic
1053804336 9:41785742-41785764 TGGTTTTATACATTTCAGGGAGG + Intergenic
1054140947 9:61529720-61529742 TGGTTTTATACATTTCAGGGAGG - Intergenic
1054192640 9:61997233-61997255 TGGTTTTATACATTTCAGGGAGG + Intergenic
1054321742 9:63676426-63676448 TGCTTTTATACATTTTAGAGAGG + Intergenic
1054452488 9:65410607-65410629 TGGTTTTATACATTTTAGGGAGG + Intergenic
1054543754 9:66296500-66296522 TGCTTTTATACATTTTAGAGAGG - Intergenic
1054626158 9:67400334-67400356 TGGTTTTATACATTTCAGGGAGG - Intergenic
1054645764 9:67591458-67591480 TGGTTTTATACATTTCAGGGAGG - Intergenic
1054858015 9:69922063-69922085 TGGTTTTATATATTTTAGAGAGG - Intergenic
1055649484 9:78393272-78393294 TGGTTTTACACAATGTAGGTAGG + Intergenic
1055649584 9:78394246-78394268 TAGTTTTATACATTTTAGGGAGG - Intergenic
1055682755 9:78734795-78734817 TTGGTATACACATTTTTGGGTGG + Intergenic
1056208767 9:84344882-84344904 TGGTTTTATACATTTTAAAAAGG - Intergenic
1056642195 9:88381134-88381156 TGATTTTATATATTTTAGGGAGG - Intergenic
1056876049 9:90331747-90331769 TGGTTTTACACATTTTAGGGAGG - Intergenic
1056955709 9:91079414-91079436 TGGTTTTATACATTTTAGGGAGG - Intergenic
1057349294 9:94281652-94281674 TAGTTTTATATATTTTGGGGAGG + Intronic
1057373867 9:94500469-94500491 TGGATTTACACTTTTTTTGGGGG + Intergenic
1058301116 9:103374044-103374066 TGCTTTTATACATTTTAGGGAGG - Intergenic
1058705194 9:107632063-107632085 TGGTGTTTCACAGTTTGGGGTGG - Intergenic
1058787701 9:108406461-108406483 TGGATTTATACATTTTAGGGAGG - Intergenic
1058811806 9:108646764-108646786 TGGTTATGCTCATTTTAGGGGGG + Intergenic
1058997480 9:110314288-110314310 TGGTTTTATACATTGTAGGGAGG - Intronic
1059214535 9:112548400-112548422 TGGTTTCATACATTTTAGGGAGG - Intronic
1059523673 9:114968455-114968477 TGGTTTTATACATTTTAGGGAGG - Intergenic
1059872051 9:118588287-118588309 TGGTTTTATAGATTTTAAGGAGG + Intergenic
1061521546 9:131121093-131121115 TGCTGTTCCACCTTTTAGGGAGG + Exonic
1061737050 9:132668874-132668896 TGGTTTTATACATTCTAGAGAGG + Intronic
1062258487 9:135643772-135643794 TGGTTTTATATATTTTAGGAAGG + Intergenic
1062258831 9:135647195-135647217 TGGTTTTATGCATTTTAAGGAGG - Intergenic
1202788769 9_KI270719v1_random:63205-63227 TGCTTTTATACATTTTAGAGAGG + Intergenic
1203583127 Un_KI270746v1:33203-33225 TGGTTTTATTCATTTTAGGGAGG + Intergenic
1203605527 Un_KI270748v1:54678-54700 TGGTTTTATGCATTTTAGAAAGG + Intergenic
1185577859 X:1187848-1187870 TGGTTTTATACATTTTAGGGAGG + Intronic
1185681343 X:1890979-1891001 TGGTTTTATACATTTTAGAAAGG + Intergenic
1185712256 X:2313813-2313835 TGATTTTATATATTTTAGGAAGG + Intronic
1185738918 X:2514672-2514694 TGGTTTTATGCATCTTAGGGAGG + Intergenic
1185760866 X:2689544-2689566 TGGTGTTATACGTTTTAGGGAGG - Intergenic
1185782858 X:2864252-2864274 TGCTTTTATACAATTTAGAGAGG + Intronic
1185792987 X:2941742-2941764 TGGTTTTATACATTTTAGGGAGG - Intronic
1185795637 X:2962157-2962179 TTGTTTTATACATTTTAGGGAGG - Intronic
1185894394 X:3844477-3844499 TGGTTTTATACATTTTAGGAAGG - Intergenic
1185899512 X:3882901-3882923 TGGTTTTATACATTTTAGGAAGG - Intergenic
1185904628 X:3921330-3921352 TGGTTTTATACATTTTAGGAAGG - Intergenic
1185908950 X:3964965-3964987 TGGTTTTATACATTTTAGGGAGG - Intergenic
1185910551 X:3976758-3976780 TGGTTTTATATATTTTAGGGAGG + Intergenic
1186012925 X:5157003-5157025 TGGTTTTATATATTTTACGAAGG - Intergenic
1186255580 X:7714942-7714964 TGGTTTTATACATTTTAGGGAGG + Intergenic
1186340754 X:8643992-8644014 TGGTTTTATACATTTTAGGGAGG - Intronic
1187057300 X:15753078-15753100 TGTTTTTATACATTTTAGAGAGG - Intronic
1187101730 X:16199737-16199759 TAGTTTTGCACATTTTAGGGAGG - Intergenic
1187806780 X:23129303-23129325 TGGTTTTATACATTTTAGGGAGG - Intergenic
1188155979 X:26744288-26744310 TGGTTTTATACATTTTAGGGAGG + Intergenic
1188285998 X:28326200-28326222 TGGTTTTATATATTTTAGGGAGG + Intergenic
1188330940 X:28870929-28870951 TGGTTTTAAACCTTTTAGTTAGG + Intronic
1188366073 X:29316539-29316561 TGGTTTTATACATTTTATGAAGG + Intronic
1188390312 X:29611495-29611517 TGGCTTTATATATTTTAGGAAGG - Intronic
1188439646 X:30202784-30202806 TGGTTTTATTTATTTTAGGGAGG - Intergenic
1188643006 X:32529267-32529289 TGGTTTTACACATTTTAGGGAGG - Intronic
1188841430 X:35022641-35022663 AGGTTTTTTGCATTTTAGGGAGG + Intergenic
1188875975 X:35430692-35430714 TGGTTTTGTATATTTTAGGGAGG + Intergenic
1188876772 X:35440396-35440418 TGGTTTTATACATTTTAGGGAGG - Intergenic
1188884846 X:35536999-35537021 TGGTTTTATATATTTTAGGGAGG + Intergenic
1188937759 X:36198186-36198208 TGGTCTTATACATTTTAGGGAGG + Intergenic
1189081032 X:37972701-37972723 TGGTTTTACATATTTTAGGAAGG + Intronic
1189176109 X:38959057-38959079 TGATTTTATATATTTTAGGGAGG + Intergenic
1189634595 X:42992618-42992640 TGGTTTTATACATTTCAGGGAGG - Intergenic
1189784491 X:44547230-44547252 TGGTTTTATACATTTTAGAGAGG + Intergenic
1190371899 X:49750683-49750705 TGGTTTTATGTATTTTAGGGAGG + Intergenic
1190633636 X:52413017-52413039 TCGTTTGACACATTTTACTGAGG + Intergenic
1190810762 X:53881265-53881287 TGGTTTTATATATTTTAGGGAGG - Intergenic
1191200861 X:57779781-57779803 TGGTTTTATACATTTTAGGAAGG + Intergenic
1191625995 X:63272005-63272027 TGGTTTTATATATTTTAGGGAGG + Intergenic
1191638256 X:63401535-63401557 TGGTTTTATATATTGTAGGGAGG - Intergenic
1191642525 X:63442764-63442786 TGGTGTTATACATTTTAGGGAGG - Intergenic
1191830885 X:65415005-65415027 TTGTTTTATACATTTTGGGAAGG + Intronic
1192132488 X:68565625-68565647 TGGTTTCATACATTTTAGGGAGG - Intergenic
1192703941 X:73508731-73508753 TGGTTTTATACATTTTACAGAGG + Intergenic
1192803592 X:74491231-74491253 TGGTTTTGTACATTTTAGAGGGG + Intronic
1193537880 X:82736504-82736526 TGGTTTTATATATTTTAGGAAGG + Intergenic
1193539006 X:82747737-82747759 TGGTTTTATATATTTTAGGAAGG + Intergenic
1193708716 X:84855069-84855091 TAGTTTTATACATTTTAGGGAGG + Intergenic
1193709652 X:84863435-84863457 TGGTTTTATACATTGTAGGGAGG + Intergenic
1193710556 X:84873821-84873843 TGGTTTTATATATTTTAGGGAGG - Intergenic
1193809615 X:86036209-86036231 TGGTTTTATATATTTTAGGGAGG + Intronic
1194003717 X:88464474-88464496 TGGTTTTAGACATTTTAGGGAGG - Intergenic
1194004231 X:88470680-88470702 TGGTTTTAGACATTTTGGGGAGG - Intergenic
1194138867 X:90182518-90182540 TGGTTTTGTATATTTTAGGGAGG - Intergenic
1194204875 X:91001303-91001325 TAGTTTTATACATTTTAGGGAGG - Intergenic
1194205930 X:91011006-91011028 TGGTTTTATATATTTTAAGAAGG - Intergenic
1194256639 X:91643453-91643475 TGATTTTATACATTTTAGGGAGG - Intergenic
1194351953 X:92831669-92831691 TGGTTTTATACATTTTAGGGAGG - Intergenic
1194476411 X:94364916-94364938 TGGTTTTATACATTTTAAGGAGG - Intergenic
1194485917 X:94486025-94486047 TGGTTTTATACATTTGAGAGAGG + Intergenic
1194822250 X:98523994-98524016 TGTTTTTATACATTTTAGGAAGG - Intergenic
1195256495 X:103096132-103096154 TGGTTTTATACATTTTAGGGAGG - Intergenic
1195578510 X:106476341-106476363 TGGTTTTATACATTCCAGGGAGG - Intergenic
1195981713 X:110585554-110585576 TGGTTTTATAAATTTTAGGGAGG - Intergenic
1196408025 X:115386219-115386241 TGGTTTGGCACATCTTAGGCTGG - Intergenic
1196492534 X:116285509-116285531 TGGCTTTATACATTTTAGGGAGG + Intergenic
1196766042 X:119244452-119244474 TGGTTTTACCCACTATAGTGTGG + Exonic
1196773305 X:119317155-119317177 TGGTTTTATACATTTTAGGGAGG - Intergenic
1197352523 X:125395508-125395530 TGGTTTTATACATTTTAGGGAGG + Intergenic
1197479378 X:126963417-126963439 TGGTTTTATATATTTTAGGGAGG - Intergenic
1197498183 X:127211430-127211452 TGGTTTTACACATTTTAGGGAGG - Intergenic
1198048106 X:132922659-132922681 TGGTTGTATACATTTTAGGGAGG + Intronic
1198258502 X:134945958-134945980 TGGTTGTATACATTTTAGGGAGG - Intergenic
1198434878 X:136607467-136607489 TAGTTTTATACATTTTAGAGAGG + Intergenic
1199081880 X:143586374-143586396 TGGTTTTACACATTTTAGGGAGG + Intergenic
1199279254 X:145980922-145980944 TGGTTTTATACATTTTAGGGAGG - Intergenic
1199357842 X:146882161-146882183 TGGTTTTATACATTTTAGGGAGG + Intergenic
1199700881 X:150374827-150374849 TGGTTTTTCACATTTCAGTACGG + Intronic
1199882251 X:151983117-151983139 TGGTTTTCCACAGCTTTGGGAGG - Intergenic
1200293495 X:154894174-154894196 TGGTTTTATACATTTTAGAGAGG - Intronic
1200383967 X:155870022-155870044 TGGTTTTATACATTTTAGGGAGG + Intergenic
1200408657 Y:2840333-2840355 TGGTTTCATACATTTTAGGAAGG - Intergenic
1200410903 Y:2860522-2860544 TGGTTTTATACATTTTAGAGAGG - Intronic
1200441990 Y:3221745-3221767 TGGTTTTATACCTTATAGGGAGG + Intergenic
1200484670 Y:3752751-3752773 TGGTTTTGTATATTTTAGGGAGG - Intergenic
1200550702 Y:4576448-4576470 TAGTTTTATACATTTTAGGGAGG - Intergenic
1200551686 Y:4585814-4585836 TGGTTTTATATATTTTAAGAAGG - Intergenic
1200575356 Y:4882715-4882737 TGATTTTATACATTTTAGGGAGG - Intergenic
1200660260 Y:5948360-5948382 TGGTTTTATACATTTTAGGGAGG - Intergenic
1200801508 Y:7391454-7391476 TGGCTTTACATATTTTAGGAAGG - Intergenic
1201261055 Y:12159273-12159295 TGGTTTTATACATTTTAGAGAGG - Intergenic
1201280129 Y:12335344-12335366 TGGTTTTATACATTTTAGGGAGG + Intergenic
1201328892 Y:12797307-12797329 TGGTTTTACACATTTTAGGGAGG + Intronic
1201439031 Y:13988094-13988116 CAGTTTTTCCCATTTTAGGGAGG + Intergenic
1201445542 Y:14054614-14054636 CAGTTTTTCCCATTTTAGGGAGG - Intergenic
1201472250 Y:14346401-14346423 TGGTTTTACACATTTTAGGGAGG - Intergenic
1201601069 Y:15728911-15728933 TGGTTCTTCACATTTTAGAGAGG - Intergenic
1201601137 Y:15729783-15729805 TGGTTTTATATATTTTAGAGAGG + Intergenic
1201694496 Y:16810017-16810039 TGGTTTTATACATTTTAGGAAGG - Intergenic
1201891084 Y:18944886-18944908 TGGTTTTAAACATTTTAGAGAGG + Intergenic
1201978821 Y:19884032-19884054 TGGTTTTACATATTTTAGGGAGG - Intergenic
1202059909 Y:20875913-20875935 TGGTTTTATATATTTTACAGAGG + Intergenic
1202387709 Y:24341119-24341141 TGGTTTTATGCATTTTAGAAAGG + Intergenic
1202483077 Y:25329009-25329031 TGGTTTTATGCATTTTAGAAAGG - Intergenic