ID: 1153846305

View in Genome Browser
Species Human (GRCh38)
Location 18:9052643-9052665
Sequence GACAGGAGGTTGACAACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153846300_1153846305 2 Left 1153846300 18:9052618-9052640 CCAGCAAACACTTTGGAAAGTGT No data
Right 1153846305 18:9052643-9052665 GACAGGAGGTTGACAACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153846305 Original CRISPR GACAGGAGGTTGACAACAAG GGG Intergenic
No off target data available for this crispr