ID: 1153847365

View in Genome Browser
Species Human (GRCh38)
Location 18:9062089-9062111
Sequence CAGAATAATGAGAAGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153847365_1153847369 8 Left 1153847365 18:9062089-9062111 CCCACATACTTCTCATTATTCTG No data
Right 1153847369 18:9062120-9062142 TTCAGAATTACCTAGTCCAAGGG No data
1153847365_1153847368 7 Left 1153847365 18:9062089-9062111 CCCACATACTTCTCATTATTCTG No data
Right 1153847368 18:9062119-9062141 CTTCAGAATTACCTAGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153847365 Original CRISPR CAGAATAATGAGAAGTATGT GGG (reversed) Intergenic
No off target data available for this crispr