ID: 1153855835

View in Genome Browser
Species Human (GRCh38)
Location 18:9145632-9145654
Sequence CAGTGCCAGTGGCAAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 366}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153855830_1153855835 30 Left 1153855830 18:9145579-9145601 CCATCACGTTGTAAATGGTTAGC 0: 1
1: 0
2: 3
3: 6
4: 46
Right 1153855835 18:9145632-9145654 CAGTGCCAGTGGCAAGAGGGTGG 0: 1
1: 0
2: 0
3: 28
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153855835 Original CRISPR CAGTGCCAGTGGCAAGAGGG TGG Intronic
900122321 1:1054103-1054125 CACTGCCAGTGGGAGGAGGAAGG + Intronic
900714220 1:4133630-4133652 CAAGGGCATTGGCAAGAGGGTGG - Intergenic
900948572 1:5844902-5844924 CAGTGCCCATGGCAAGGGGCAGG - Intergenic
901791442 1:11655303-11655325 AGGTGGGAGTGGCAAGAGGGTGG - Intronic
901872887 1:12148478-12148500 CAGGGACAGTTGCAAGAGGCAGG + Intergenic
902726131 1:18337468-18337490 CAAAACCAGGGGCAAGAGGGAGG - Intronic
902797346 1:18808150-18808172 CCCTTCCAGTGGCAGGAGGGAGG + Intergenic
903049375 1:20589367-20589389 CACAGGCAGTGGCAAGAGCGCGG + Intronic
903458942 1:23507601-23507623 AAGTGTCACTGGCAAGACGGGGG + Exonic
904116180 1:28163703-28163725 CTGGGCCAGTGGGGAGAGGGAGG - Intronic
904526605 1:31138430-31138452 GAGTGCCAGTGGCATGATCGCGG + Intergenic
904537213 1:31207774-31207796 CAGTGCAAGTCCCCAGAGGGTGG - Intronic
905473033 1:38207347-38207369 CAGTGCCTGAGGCAGGAGGCAGG + Intergenic
906108363 1:43307834-43307856 CAGTGCCAGTGTCAGAATGGTGG + Exonic
906208522 1:43999627-43999649 CTGGGCCAGTGGCCAGAGCGGGG + Intronic
906662576 1:47593377-47593399 CAGAGCCAGGGGCTAGGGGGAGG + Intergenic
908070549 1:60455173-60455195 CAGTGACAGTGGCAGCAGGCAGG - Intergenic
909183058 1:72449731-72449753 CAGTGCCAGTGGCCCCAGGAAGG - Intergenic
909722798 1:78796129-78796151 CAAGGCCAGTGGCAACAGTGGGG - Intergenic
910530621 1:88231283-88231305 CTGTGCCAATGGAAAGAGAGTGG + Intergenic
913079075 1:115364992-115365014 GACTGCCAGTGGGAAGAGGTCGG + Intergenic
914707068 1:150179150-150179172 CAGAGGCAGTGGGAAGGGGGTGG - Intergenic
915610511 1:156988262-156988284 CAGTGCCTGACGCAATAGGGAGG + Intronic
916689916 1:167180292-167180314 CAGTGCCAAAGGGAAGAGAGAGG + Intergenic
917936427 1:179872122-179872144 CAGTTCCTGGGGCAAGAGAGAGG - Intronic
919043665 1:192424549-192424571 CAGTGGCAGTGGCCACAGGCAGG - Intergenic
919983762 1:202658796-202658818 CACTGGCAGGGGCAAGAGGAGGG - Intronic
920194485 1:204217816-204217838 CAGAGCCAGTGGCAAGGGCTTGG - Intergenic
920295253 1:204952148-204952170 CAGGCCCAGAGGCAAGCGGGTGG - Intronic
921218479 1:212956377-212956399 CAGTGCCTGTGTGAAGAGGTTGG + Intronic
921964156 1:221070182-221070204 CATCGCCAGTGGCAAGTTGGTGG - Intergenic
923503137 1:234582809-234582831 CAGTGGCTGTGGCAGGAAGGGGG - Intergenic
1063674868 10:8131914-8131936 CAGTGAAAGTGGCAAGCAGGGGG - Intergenic
1063928998 10:11010308-11010330 CAGACCCAGAGGGAAGAGGGAGG - Intronic
1063982125 10:11462806-11462828 CAGCACCAGTGTCAACAGGGAGG + Exonic
1067182594 10:44000229-44000251 CAGTGGCAGTGCCCAGAGTGGGG - Intergenic
1067310987 10:45113445-45113467 CAGTGACAGTGGAGACAGGGAGG - Intergenic
1068061441 10:52072762-52072784 CAGGAACAGTGGCATGAGGGTGG - Intronic
1069940478 10:71951947-71951969 CAGTGCTATGGGCAAAAGGGAGG + Intergenic
1071582930 10:86790103-86790125 CAGTGGCAGTGGCAAGATCTCGG - Intronic
1071750070 10:88465495-88465517 CAGTGCCAGTAAAAAGAGTGAGG + Intronic
1072258970 10:93649198-93649220 CAGGGCCCGTGGCCAGAGGCTGG + Intronic
1072621981 10:97085953-97085975 CAACGCCAGTGGCAAGAATGTGG + Intronic
1073068481 10:100778632-100778654 CAGTCCCAGGGCCAAGACGGAGG - Intronic
1074759578 10:116656873-116656895 CAGACCAACTGGCAAGAGGGAGG - Intergenic
1075139455 10:119818476-119818498 CAGTGCCTGCGGCTGGAGGGGGG - Intronic
1075316379 10:121456982-121457004 CAGTTCCCGTGGAGAGAGGGAGG + Intergenic
1076453510 10:130573531-130573553 CGGAGCCAGTGGCATGAGGATGG - Intergenic
1077112778 11:869241-869263 CAGGACCAGTTTCAAGAGGGTGG + Exonic
1077304951 11:1864829-1864851 CTGTGCCAGGTGCCAGAGGGAGG + Intronic
1077489118 11:2852461-2852483 TAGGGCCAGAGGCAAGAGCGGGG - Intergenic
1078421399 11:11215996-11216018 CAGTGGCAATGGCAGCAGGGTGG - Intergenic
1078442508 11:11379136-11379158 CAGGGTCAGTGGCTGGAGGGCGG - Exonic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079182271 11:18204320-18204342 CAGTGGCAGTGGCATGAGGCAGG - Intronic
1081489179 11:43554181-43554203 CAGTGGCAGCAGCAAAAGGGAGG - Intergenic
1081671878 11:44947066-44947088 CAGAGCAGGTGGCAAGAAGGAGG + Intronic
1081897741 11:46601375-46601397 CACTGCCAAAGGCAAGAGGTAGG + Intergenic
1083102605 11:60325706-60325728 CAGTGCTAGTGGGTGGAGGGTGG - Intergenic
1083417613 11:62535813-62535835 CATTCCCAGTGGCATCAGGGTGG - Intronic
1083939391 11:65887529-65887551 CTGGGCCAGTGGCCAAAGGGAGG + Intronic
1084427588 11:69094121-69094143 CAGTGCCAGGGGCAGCAGTGGGG + Intergenic
1087181118 11:95143625-95143647 CAGGGCCAGTGGCAGGAGGATGG + Intergenic
1088011401 11:105005662-105005684 CAGAGGCTGTGGCAAGAAGGAGG - Intronic
1089006043 11:115091531-115091553 CAGTGGCAGTGGGAAGAGTAGGG + Intergenic
1089562407 11:119350670-119350692 CAGCCCCGGTGGCAAGAGGAGGG + Intergenic
1089618355 11:119707924-119707946 CAGTGGTAGTGGCAAGAGGAAGG + Intronic
1090138230 11:124223212-124223234 CAGAGCCAGTGGAAGGTGGGAGG - Intergenic
1090847826 11:130545797-130545819 CTGTGCCAGAGCCATGAGGGAGG + Intergenic
1090985316 11:131761137-131761159 CCGTGAAAGTGGCAAGAGGCAGG + Intronic
1091058860 11:132443350-132443372 CAGTGGGAGTGGGCAGAGGGTGG + Intronic
1091889100 12:4038942-4038964 CAGAGCATGTTGCAAGAGGGTGG + Intergenic
1092029232 12:5270050-5270072 CAGTGCCATAAGCAAGAGGGCGG - Intergenic
1096872108 12:54599488-54599510 CAGTGGAAGTGGAAACAGGGTGG + Intergenic
1098876539 12:75871858-75871880 CAGTGGGAGTGGGAGGAGGGAGG - Intergenic
1100510699 12:95269453-95269475 AAGTGCCAGTGGCAGCAGGTGGG + Intronic
1101254816 12:102966406-102966428 CAGGGCCTTTGGCAAAAGGGAGG + Intergenic
1101471230 12:104999089-104999111 CAGTGGCAGTGGCAGCATGGTGG + Intronic
1102906586 12:116680748-116680770 CATTGCCAGGAGCTAGAGGGAGG + Intergenic
1103308952 12:119989476-119989498 CAGCGGCAGCGGCAACAGGGCGG + Intergenic
1103704555 12:122864252-122864274 CAGTGACAGGTCCAAGAGGGTGG - Intergenic
1103866285 12:124054621-124054643 CAGAGCAAGTGAGAAGAGGGAGG + Intronic
1103947611 12:124535269-124535291 CAGTGTCAGTGTCAGGAGGGTGG - Intronic
1104703687 12:130926633-130926655 CAGTGCCAGTGGCACGATCTTGG + Intergenic
1104920232 12:132286621-132286643 CGGTGCCAGGCGGAAGAGGGAGG + Intronic
1105630374 13:22157635-22157657 AAGAGCCAGGAGCAAGAGGGAGG + Intergenic
1105683258 13:22751881-22751903 CAAAGACGGTGGCAAGAGGGAGG - Intergenic
1105899460 13:24742920-24742942 CACTGACTTTGGCAAGAGGGTGG + Intergenic
1107549550 13:41462098-41462120 CATTCCCTGTGGCAAAAGGGAGG + Intronic
1107840397 13:44451320-44451342 CACTGCTACTGCCAAGAGGGAGG + Intronic
1108284315 13:48891019-48891041 CACTCACAGTGGCAAGAGGAGGG + Intergenic
1108314389 13:49223043-49223065 CAGTGCCACTGGCCATGGGGTGG + Intergenic
1109510621 13:63367659-63367681 CAGAGCCACGGGCCAGAGGGTGG - Intergenic
1110303166 13:73952915-73952937 CAGTGGCAGTGGGAAGAAAGAGG + Intronic
1111420141 13:88000483-88000505 CATTGGCAGTGGCAGAAGGGAGG + Intergenic
1112149519 13:96742187-96742209 CCAAGCCAGTGGCAAGAGGCAGG + Intronic
1112296386 13:98190990-98191012 CAGTGCCAGAGGCAGGACCGGGG - Intronic
1114654789 14:24309737-24309759 CAGGGCCTGAGGCAAGAGGTGGG + Intronic
1114779454 14:25521747-25521769 CAGTGCCAATGACAAAAAGGAGG - Intergenic
1116249967 14:42469049-42469071 GATTGCCAGGGGCTAGAGGGAGG + Intergenic
1116973771 14:51094589-51094611 CAGGGCCGGTGACAAGTGGGTGG + Exonic
1117213489 14:53526165-53526187 CAGAGCCTTTGGCAAGAGGCAGG + Intergenic
1117673648 14:58133225-58133247 CAGAGACAGTGGCAAGACTGAGG - Exonic
1118867285 14:69713378-69713400 CAAAGCCAGTGACAAGAAGGAGG - Exonic
1120628172 14:86855407-86855429 CAGAGCCAATGGCTAGAAGGTGG - Intergenic
1122817053 14:104319049-104319071 CTGTGCCAGCGCCAAGAGTGGGG + Intergenic
1122890182 14:104728659-104728681 GAGTGCCAGTGCCAAGAGGTTGG + Intronic
1123755704 15:23396125-23396147 CAGAGAGAGTGGGAAGAGGGGGG - Intergenic
1123778034 15:23599961-23599983 CAGGGCCAGTGGGAAAAGCGGGG - Intronic
1124017590 15:25890581-25890603 CAGTGCCAGGGGCGAGTGGGTGG + Intergenic
1126464736 15:48951334-48951356 CAGTGGCACTGGGAAGAGAGGGG - Intronic
1127818093 15:62630421-62630443 CAGGGCCAGTGGGAACAGAGTGG - Intronic
1128639764 15:69327701-69327723 CAGTGGCAGTGGCTGCAGGGAGG + Intronic
1128756748 15:70188399-70188421 CAGTGCCAGGAGCAAGATGCTGG + Intergenic
1128797920 15:70478575-70478597 CAGGGCGAGTGGGAGGAGGGTGG - Intergenic
1129458863 15:75689969-75689991 CAGTGTCAATGGCCAGAGGCGGG - Exonic
1129693801 15:77729176-77729198 CAGTGCCAGTGGGGAGATGATGG + Intronic
1130273010 15:82462122-82462144 CAGTGTCAATGGCTAGAGGCAGG + Intergenic
1130307890 15:82726975-82726997 CAGTGCCATTGGCACCATGGGGG - Intergenic
1130465360 15:84189481-84189503 CAGTGTCAATGGCTAGAGGCAGG + Intergenic
1130487329 15:84405327-84405349 CAGTGTCAATGGCTAGAGGCAGG - Intergenic
1130498905 15:84484055-84484077 CAGTGTCAATGGCTAGAGGCGGG - Intergenic
1130587651 15:85194088-85194110 CAGTGTCAATGGCTAGAGGCAGG + Intergenic
1130754878 15:86752606-86752628 CATTGCCAGGGGCCAGAGGCTGG + Intronic
1130807816 15:87344989-87345011 CAGTGCCATGGGCTAGAGGAAGG - Intergenic
1130903572 15:88224868-88224890 CAGCTCCAGTGCCAAGAGTGAGG - Intronic
1131225928 15:90624393-90624415 CAGGGACTGTGGAAAGAGGGAGG - Intronic
1132744643 16:1431601-1431623 CGGAGCCTGTGGCAGGAGGGCGG - Intergenic
1134251920 16:12580306-12580328 GAGTGCCAGTGGCCAGGGGTTGG + Intergenic
1134862610 16:17574108-17574130 CAGTGTCAGTGAGAAGAGGGAGG + Intergenic
1136133028 16:28236346-28236368 TAGTGGCAGTAGCAAGAGAGAGG + Intergenic
1136237654 16:28924762-28924784 CAGAGCGAGTGGGAAGGGGGCGG - Intronic
1137556717 16:49474852-49474874 CAGAGTCTGTGGCAAGGGGGTGG + Intergenic
1138729770 16:59182283-59182305 CTGTGCCAGTGGCAGTAGGGTGG + Intergenic
1139372927 16:66479772-66479794 CAGTGGCAGTGGGAAGAGAAAGG + Intronic
1139961251 16:70718757-70718779 CAGGGCCAGTGGCAGGGAGGTGG - Intronic
1140204506 16:72922437-72922459 TTATGCCAGTGTCAAGAGGGAGG + Intronic
1140735479 16:77894356-77894378 CAGTGTCAGTAGAAAGATGGGGG + Intronic
1140899726 16:79356672-79356694 GAGAGCCAGTGGAAAGTGGGGGG - Intergenic
1141033079 16:80606554-80606576 CAGAGGAAGTGGCAAGAGTGAGG - Intronic
1142121396 16:88388254-88388276 CAGAGCCAGAGGCAGGATGGGGG + Intergenic
1142184927 16:88690311-88690333 CAGTGCCAGTGCCAGGTGGCTGG + Intergenic
1142589883 17:998646-998668 GAGTTTGAGTGGCAAGAGGGGGG + Intronic
1142788312 17:2243038-2243060 CAGTGGCAGTGGCAGGACGGGGG + Intronic
1142860471 17:2757808-2757830 CAGTGCCAGGGGCAAGAGTTGGG - Intergenic
1143510640 17:7393631-7393653 CCCTGGCAGTGGCAAGAAGGGGG + Exonic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144460943 17:15458192-15458214 CAGAGCCAGAGGAAACAGGGTGG - Intronic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144810798 17:17997684-17997706 CAGTGGGAGTGGCAAGAGCAGGG - Intronic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1147238429 17:39074676-39074698 CAGTGTCAGAGGCTAGAAGGGGG - Intronic
1148246298 17:46033034-46033056 CAGGGCCTGTGGAGAGAGGGTGG - Intronic
1148440960 17:47711384-47711406 CAGTGCCAGGGGCACCAGGAGGG - Exonic
1148752466 17:49953141-49953163 CAGGGGGAGTGGGAAGAGGGAGG + Intergenic
1149923222 17:60678046-60678068 CAGTGCAAGGGGCCGGAGGGCGG + Intronic
1150223000 17:63507791-63507813 GAGTGCCTGGGGCAGGAGGGAGG + Intronic
1150316741 17:64175320-64175342 CAGTGCCAGAGGCTAGAGGTGGG - Intronic
1151258467 17:72898168-72898190 CAGTTCCAGTGGACAGATGGTGG + Intronic
1151383257 17:73739963-73739985 CAGAGCCAGGGTCAGGAGGGTGG - Intergenic
1151424720 17:74023538-74023560 CAATCCCAGAGGCCAGAGGGTGG + Intergenic
1151952815 17:77364581-77364603 CAGTGGCAGTGAGGAGAGGGGGG + Intronic
1152257172 17:79246848-79246870 CAGTGCCAATGGGATGGGGGTGG + Intronic
1152272290 17:79331754-79331776 CACTTCCAGTGGGAAGATGGGGG - Intronic
1152295307 17:79463857-79463879 CAGTGGCAGTGGCGATGGGGAGG - Intronic
1152521685 17:80860162-80860184 CAGTGCCAGTGACTGGACGGAGG - Intronic
1153801650 18:8676184-8676206 CTGAGCCAGTGGCTGGAGGGTGG + Intergenic
1153855835 18:9145632-9145654 CAGTGCCAGTGGCAAGAGGGTGG + Intronic
1155559786 18:27063113-27063135 CAGTCCCAGGGGAAAGAAGGGGG + Intronic
1156445188 18:37231484-37231506 CAGAGGGAGTGCCAAGAGGGAGG + Intronic
1156600875 18:38604524-38604546 CACTGCCACTGCCAAGAAGGGGG + Intergenic
1157218571 18:45807011-45807033 CAGTGCTATTGGCAGGCGGGGGG + Intergenic
1157417911 18:47521364-47521386 CAGTGGCAGTGGCATCATGGAGG + Intergenic
1160185193 18:76670988-76671010 CAGAGCGGGTGGCAACAGGGAGG + Intergenic
1160906444 19:1453725-1453747 CAGTGCCATATGCAAGTGGGTGG - Intronic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1161566535 19:5005834-5005856 CAGGGCCAGTGCCAAGCAGGGGG - Intronic
1161845663 19:6710689-6710711 CGGTGCCAGCGGCCAGAGGGAGG - Exonic
1162590444 19:11587891-11587913 CAGGCCTAGTGGCAAGTGGGGGG - Intronic
1162907756 19:13833667-13833689 CAGGGCCCGTCGCTAGAGGGCGG + Intergenic
1163883885 19:19949435-19949457 CAGTGCTATGGGCAAAAGGGAGG - Intergenic
1165553076 19:36605184-36605206 TAGTGCCAGCCGCAATAGGGCGG + Intronic
1165924103 19:39316518-39316540 CAATGCCAGAGGCGGGAGGGGGG - Intergenic
1166585942 19:43949139-43949161 CAGTGGCAGTGGCAACATGGTGG + Intergenic
1167877417 19:52425918-52425940 CACTGCCAGTGCCAGGAGCGAGG - Intergenic
1168520121 19:57043526-57043548 CAGGGCCAGTGGCAGGAATGGGG - Intergenic
925711221 2:6742773-6742795 CGGTGCCACTGGCCAGAGCGCGG - Intergenic
926242510 2:11099577-11099599 CAGTGCCAGGGGCACTAGGCTGG - Intergenic
927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG + Intergenic
929422493 2:41807314-41807336 CAGTGCCAGTGGCTACACAGAGG + Intergenic
929489712 2:42385374-42385396 CAGGGACTGTGGAAAGAGGGAGG + Intronic
930166546 2:48209194-48209216 CAGTGCCTGTGGTAAAAAGGAGG - Intergenic
930942967 2:57035800-57035822 ATGTTCCAGTGGCAACAGGGTGG + Intergenic
931430939 2:62208607-62208629 CAGAGCCAGGGACCAGAGGGAGG + Intronic
931712982 2:65005553-65005575 AAGTGTCTGTGCCAAGAGGGTGG - Intronic
932129968 2:69178543-69178565 AGGGGCCAGCGGCAAGAGGGAGG + Intronic
932129977 2:69178563-69178585 AGGGGCCAGGGGCAAGAGGGAGG + Intronic
933632667 2:84674750-84674772 CAGTGCCATGGGGATGAGGGTGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934119879 2:88828575-88828597 CAGGGCCAGTGACACGCGGGTGG - Intergenic
934524896 2:95045691-95045713 CACATCCAGTGGGAAGAGGGAGG - Intronic
934606714 2:95700672-95700694 CAGTGCCTGTGACAAGAAGGAGG - Intergenic
935212617 2:100951658-100951680 GAGTGCCAGGGGCTGGAGGGAGG + Intronic
935591013 2:104845254-104845276 CAGTGACAAAGGCAAGCGGGCGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936024189 2:109018692-109018714 GAGTGCCAGTGGAAAGGGGATGG - Intergenic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936163354 2:110101113-110101135 CAGGGCCAGTGACACGGGGGTGG - Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937880660 2:126862078-126862100 CACTGGCAGTGCCAAGAGTGGGG + Intergenic
938095440 2:128458336-128458358 CAGTGACAGTGGCATGTGAGGGG - Intergenic
938182532 2:129196182-129196204 CAGTGACACTGGCATCAGGGAGG + Intergenic
938403817 2:131016097-131016119 TAGTCCCAGAAGCAAGAGGGTGG - Intronic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
941519353 2:166520008-166520030 CAGTGAAAGTGGAAAGAGAGTGG - Intergenic
943772497 2:191733481-191733503 CAGAACCAGTGGAAGGAGGGTGG + Intergenic
944285266 2:197942357-197942379 CAGTGGTAGTGGCAATACGGAGG - Intronic
944389934 2:199207308-199207330 CAGATCCAGAGGCAATAGGGAGG + Intergenic
944416034 2:199480733-199480755 CAGTAGCAGTGGGAACAGGGAGG + Intergenic
944436579 2:199696260-199696282 ATGTGCCAGTGGCAGCAGGGTGG - Intergenic
945054428 2:205855837-205855859 CACTGTCAGTGGCAACAGTGGGG + Intergenic
945487689 2:210417015-210417037 ATGAGCCAGTGGCAACAGGGTGG + Intergenic
948590134 2:239044095-239044117 CTGTGCCAGTGGGAAGGCGGAGG - Intergenic
948857612 2:240737296-240737318 CGGTGCCAGGGGGAACAGGGAGG + Intronic
948860589 2:240750907-240750929 CAGTGCCAGTGTGAAAAGGGGGG - Intronic
948948369 2:241233326-241233348 GAGGGCCAGTGGCAGGGGGGTGG + Intronic
1169379730 20:5096110-5096132 CAGAGCCAGCGGCAGGAGCGAGG - Intronic
1169915803 20:10681865-10681887 CATTGTCAGTGGCAGGAGAGAGG + Intergenic
1170029879 20:11933525-11933547 CAGGGCCATTGGCAAGAGAAGGG - Intergenic
1170548162 20:17452678-17452700 CAGTGCCGGAGGCAAGGGGCAGG - Intronic
1171311999 20:24152041-24152063 CAGTGACAGTGGGGAGAGGCGGG + Intergenic
1172136305 20:32689183-32689205 CTGTGCCAGAGCCATGAGGGAGG + Intergenic
1172226186 20:33306718-33306740 CAGTGCCAGAGGCAAAGGGAGGG + Intronic
1172714400 20:36951927-36951949 CAGTGCTGGTGGAAAGGGGGAGG + Intergenic
1174532966 20:51229449-51229471 CAGTGACAGTGACGAGCGGGAGG - Intergenic
1174872105 20:54192509-54192531 CACTGCCAGCAGCCAGAGGGTGG - Intergenic
1174896849 20:54458353-54458375 TAATACCAGGGGCAAGAGGGAGG + Intergenic
1175002922 20:55649360-55649382 CAGAGCCAGTGGAACGAGGGAGG + Intergenic
1175307589 20:57987544-57987566 CAGGGCCTGTGGCAAGAATGGGG + Intergenic
1176517357 21:7796100-7796122 CACTGCCAGTGGGACGTGGGAGG + Intergenic
1178496481 21:33090536-33090558 CAGTGCCTGAGGGAAGAAGGGGG - Intergenic
1178651385 21:34426112-34426134 CACTGCCAGTGGGACGTGGGAGG + Intergenic
1179311004 21:40196262-40196284 CAGTCCCAGCGGCAGGAGGTTGG - Intronic
1179502086 21:41816307-41816329 CACAGCCAGTGGAGAGAGGGTGG + Intronic
1179907778 21:44433189-44433211 CAGTGGCAGAGCCAGGAGGGAGG - Intronic
1179961835 21:44772001-44772023 CAGTGCCGCTGGCTAGGGGGTGG - Intronic
1179986902 21:44927238-44927260 GAGGGCCAGTGGGGAGAGGGTGG + Intronic
1180642441 22:17310126-17310148 CAGTGCCACAGGCAACTGGGAGG - Intergenic
1181403379 22:22665378-22665400 CAGTGTCTGTGGAAAGAGTGAGG - Intergenic
1181519172 22:23435491-23435513 CAGTGACATTGGGCAGAGGGAGG + Intergenic
1181557760 22:23681576-23681598 CTGTGCCCATGGCAAGAGGTGGG + Intergenic
1182333687 22:29569158-29569180 CAGTGGCAATGGCACTAGGGAGG + Intronic
1182506865 22:30789736-30789758 CAGTACCAGTGACCAGAAGGTGG + Intronic
1183243379 22:36674761-36674783 CTATGCCACTGGGAAGAGGGAGG + Intronic
1184100193 22:42338023-42338045 CAGTCACTGTGGCCAGAGGGAGG + Intronic
1184924267 22:47626198-47626220 CACAGGCAGTGGCAAGGGGGTGG + Intergenic
1184992447 22:48180126-48180148 CAGTGCCAGTGCCCAGGGTGGGG + Intergenic
1185241448 22:49749635-49749657 CAGTGCCAGGGGAAAGTAGGGGG + Intergenic
1185376924 22:50486975-50486997 CAGTGCCAGCTAGAAGAGGGCGG - Intronic
1185410151 22:50677595-50677617 GAGGGCCAGTGGCAGGAGAGGGG - Intergenic
949510052 3:4759611-4759633 GAGTTTCAATGGCAAGAGGGAGG + Intronic
949566403 3:5249115-5249137 CAGTGCTGGAGGCAGGAGGGAGG + Intergenic
950753847 3:15155772-15155794 CAGTTCCAGTGGGAGGAGGGAGG + Intergenic
952217803 3:31295140-31295162 CAGAGCCAGAGCCATGAGGGTGG - Intergenic
952810373 3:37397220-37397242 CAGTGGATGTGGCAAGATGGAGG - Intronic
952889625 3:38031325-38031347 CTGTGCCAGGGGCCAGAGGAGGG - Intergenic
954304417 3:49717900-49717922 CAGGGCGAGCAGCAAGAGGGTGG + Exonic
954379032 3:50209907-50209929 CAGTGCAAGTGGCCAGTGTGTGG - Intronic
955733932 3:62016823-62016845 CAAAGCCAGTGAAAAGAGGGTGG - Intronic
955990705 3:64624050-64624072 AAATGCCAGGGGCAGGAGGGAGG + Intronic
956885674 3:73556951-73556973 CAGTCCCAGGGGCATGTGGGAGG - Intronic
958822285 3:98989173-98989195 CAGTGGCAGGGTCAGGAGGGAGG - Intergenic
959206114 3:103309075-103309097 CAGTCCTAGTGGCGAGAGGGAGG - Intergenic
960950109 3:122993734-122993756 CAGAGCGGGTGGCAAGGGGGCGG - Intronic
961359175 3:126356798-126356820 CAGTGTCGGGGGCAAGGGGGGGG - Intronic
962305552 3:134282882-134282904 GAGCGCCAGTGGCCAGAGGAGGG + Intergenic
962375877 3:134858349-134858371 CACTGGCAGTGGCACGTGGGAGG + Intronic
963045905 3:141102575-141102597 AAGGCCCTGTGGCAAGAGGGAGG + Intronic
963294336 3:143529034-143529056 CAGTGCCGGTGCCATGTGGGAGG + Intronic
967517518 3:190387969-190387991 AAGTGCCAGTGCCAAGACGGGGG - Exonic
968591994 4:1463985-1464007 CAGAGGCAGTGGCAGGAGTGAGG - Intergenic
968801373 4:2745331-2745353 AAGTCCTAGTGGCCAGAGGGCGG + Intronic
968811495 4:2801470-2801492 CAGGCCCAGGAGCAAGAGGGAGG - Intronic
969429883 4:7147888-7147910 CAGGCCCAGAGGCAAGAGGGAGG - Intergenic
969862638 4:10049765-10049787 CAGTGCAAGAGGCCAGAGGGAGG + Intronic
971057577 4:22930971-22930993 CAATGGCAGTGGGGAGAGGGAGG + Intergenic
971279052 4:25226216-25226238 GAGTGCCTGTGACCAGAGGGGGG - Intronic
972466184 4:39359189-39359211 CAGTGGCAGTGGGAATAGAGGGG - Intronic
973789661 4:54366286-54366308 CAGCTCCAGTGGGAACAGGGAGG + Intergenic
974469759 4:62303010-62303032 CAGTGCTGGTGGCCACAGGGGGG + Intergenic
975547334 4:75573395-75573417 CAGAACTAGTGGCTAGAGGGGGG - Intergenic
977557403 4:98499256-98499278 CAGGGCCAGGGGCCAGAAGGAGG + Intronic
978807790 4:112818600-112818622 CAGGGAGAGGGGCAAGAGGGTGG + Intronic
979937117 4:126711743-126711765 CAGTGGCAGTGGCATTTGGGAGG - Intergenic
980990531 4:139735315-139735337 CAGTGTCAGTCGGAGGAGGGGGG - Intronic
981759805 4:148181831-148181853 TAGTACTAGTGGCAGGAGGGAGG + Intronic
985508410 5:298434-298456 CAATCCCAGTGGGAAGAAGGAGG + Intronic
985739636 5:1607234-1607256 CAATCCCAGTGGGAAGAAGGAGG - Intergenic
985891372 5:2717644-2717666 CAGTGCCAGTGGGAACAGAGGGG - Intergenic
986294329 5:6424457-6424479 TAGTGCCAGTGCCAGGATGGAGG - Intergenic
986482595 5:8203889-8203911 CAGGGGCATTGGCAAGATGGAGG + Intergenic
986674126 5:10168606-10168628 CTGTGCCAGTGGCAGGGGCGAGG - Intergenic
988163567 5:27552385-27552407 CATTGAAAGTGGAAAGAGGGGGG - Intergenic
988539551 5:32096711-32096733 AAGCGTCAGTGGCAAGAGGCAGG - Intronic
988709971 5:33763333-33763355 AAGTGACAGGGGCAAGAGGCTGG + Intronic
990879977 5:60528349-60528371 CAGTGCCCGAGGCAAGGGAGAGG + Intergenic
992239065 5:74746756-74746778 CAGTGCCATTGGCAATGGGGAGG - Intronic
992894716 5:81236006-81236028 CTGTGCCAGTGTGAAGAGGAAGG - Intronic
995014042 5:107290037-107290059 CAGTGCCAGTCACAAGGAGGAGG + Intergenic
996089422 5:119336301-119336323 GAGTGCCAGAGGCAGGAGGCAGG - Intronic
997350357 5:133226541-133226563 CAGAGCTAGGGGTAAGAGGGAGG - Intronic
997976776 5:138445666-138445688 CAGTGGCTGTGGAAAGAAGGAGG - Exonic
998173492 5:139886066-139886088 CATGGCCAGTGGCGAGTGGGGGG - Intronic
998409614 5:141899582-141899604 CAGTGCCACAGGGAAGAGAGGGG + Intergenic
999356887 5:150943518-150943540 CAGTCCCAGTGGAAAGATAGAGG - Intergenic
999977788 5:156929170-156929192 CCATGCCAGTGGCAAGGGGATGG + Intronic
1000500829 5:162047507-162047529 AAGTGTCAATGGCAATAGGGAGG - Intergenic
1001758034 5:174185857-174185879 CCAGGACAGTGGCAAGAGGGTGG - Intronic
1002537604 5:179886133-179886155 GAGTGCCAGGGGAAAGAAGGGGG - Intronic
1003791721 6:9553619-9553641 CAGTGATAGTGGCAGGAGGTAGG - Intergenic
1004046079 6:12024921-12024943 AAGGCCCAGTGGCAAGAGGGAGG + Intronic
1004184844 6:13413052-13413074 CAGTGGCAGAGCCAAGAGGGTGG - Intronic
1005083570 6:21981238-21981260 CAGTGCCAGAAGGAAGAGGCAGG - Intergenic
1006189084 6:32196672-32196694 CAGTGTCTGTGGAAAGGGGGGGG - Intronic
1006358152 6:33572806-33572828 CTGTGCCAGAGCCATGAGGGAGG + Exonic
1007751105 6:44072621-44072643 CTGGGCCACTGGCAAGTGGGTGG - Intergenic
1010707106 6:79127925-79127947 CAGTGGCAGTGTCAACATGGAGG - Intergenic
1012518526 6:100092355-100092377 CAGTGCCAGAAGGTAGAGGGAGG + Intergenic
1014558231 6:122859193-122859215 CAGTGTCAGCAGCAAGGGGGAGG - Intergenic
1016346266 6:143117229-143117251 AAGTGGCAGTGGCAGGAGGCAGG + Intronic
1019015496 6:168877015-168877037 CAGTGCAAGAGGACAGAGGGAGG + Intergenic
1019190938 6:170250258-170250280 CAGGCCCAGAGGCAGGAGGGTGG - Intergenic
1019418850 7:940006-940028 TTGTGCCAGTTGCAAGAGGTCGG - Intronic
1019592109 7:1840835-1840857 CAGTGACATTGGGCAGAGGGAGG - Intronic
1020787491 7:12589917-12589939 CAGTGCTATGGGCAAAAGGGAGG + Intronic
1020912900 7:14155620-14155642 CAGTGCCAATGGGAACAGAGTGG + Intronic
1021249923 7:18311944-18311966 CCGTGGTAGTGCCAAGAGGGTGG - Intronic
1023879867 7:44312279-44312301 AGGTGTCAGTGGCGAGAGGGTGG + Intronic
1024200551 7:47101868-47101890 CAGTGCCAGTGGCCAGCAGCAGG + Intergenic
1024551055 7:50562582-50562604 CATTGCCAGGGGCAAGAAAGTGG - Intronic
1025861978 7:65338834-65338856 CATTGCAAGTGGGCAGAGGGAGG + Intergenic
1028639850 7:93029834-93029856 CAGTGACAATGGCAGGAAGGTGG - Intergenic
1029655014 7:101918522-101918544 CACTGCCAGTGGGTGGAGGGTGG + Intronic
1031535636 7:122930039-122930061 GAGTGCCAGTGGCAGGGGTGGGG - Intergenic
1032757054 7:134901130-134901152 CAGATTCAGTGCCAAGAGGGAGG + Intronic
1032781589 7:135168785-135168807 CAGTGCCAGTGGCAGCAGCAAGG - Exonic
1032786952 7:135208538-135208560 CAGTGACAGTGGCAGCAGTGGGG - Intronic
1034285348 7:149880204-149880226 CAGGGCCAGGGGGCAGAGGGCGG - Exonic
1034826671 7:154271546-154271568 CAGTGCCAAAGGTAAGATGGAGG - Intronic
1035580122 8:734570-734592 GAGATGCAGTGGCAAGAGGGGGG - Intronic
1037598357 8:20373416-20373438 CACTGCCACTGGACAGAGGGCGG - Intergenic
1037934253 8:22904039-22904061 CAGTCACAGTGGCAGGAGGCAGG - Intronic
1039289382 8:36077518-36077540 CAGTGCTATTGGCACAAGGGTGG - Intergenic
1039946814 8:42136888-42136910 CAGAGACAGTGACAAGAGGAGGG + Intergenic
1040536239 8:48313475-48313497 CAGTGGAGGTGGCAAGAGGAGGG - Intergenic
1040933216 8:52756636-52756658 GAGTGGCAGTGGCAAGTTGGTGG - Intergenic
1043010753 8:74879182-74879204 CAGGGACAGTACCAAGAGGGAGG - Intergenic
1045376361 8:101578345-101578367 CATTCTCAGTGCCAAGAGGGAGG + Intronic
1047605043 8:126466401-126466423 GGGTGCCAGTGGCAGGAGTGAGG + Intergenic
1049201854 8:141344179-141344201 CAGTGGCTGTGGCAAGCGCGGGG - Intergenic
1049618587 8:143587782-143587804 CAGTGGGAGTGGCACGAGGTGGG - Intronic
1049682688 8:143926658-143926680 CAGCGCCAGTGGGGAGAGTGGGG + Intronic
1049938605 9:523374-523396 TGGTGGCAGTGGAAAGAGGGAGG - Intronic
1051548577 9:18304240-18304262 AAGTGACGGTGGCAAGAAGGGGG + Intergenic
1052214713 9:25951754-25951776 CAGAGACAGTGGAATGAGGGTGG - Intergenic
1058923269 9:109638608-109638630 CAGTGGCAGCGGCATGGGGGAGG + Intergenic
1058943001 9:109831524-109831546 CAGAGCCAGTTGCCTGAGGGAGG + Intronic
1060004540 9:119988062-119988084 CATTGCCTGTGGCAATGGGGAGG - Intergenic
1060135588 9:121150339-121150361 CAGTGCCAGGGGTGAGAGGTCGG - Exonic
1061783286 9:133008179-133008201 CACTGCCAGTGGCCAGGGGAGGG + Intergenic
1061831986 9:133301996-133302018 CAGTGTCAGTGGGTAGAGGCTGG - Intergenic
1061869486 9:133513200-133513222 CACTGCCCATGGAAAGAGGGCGG - Intergenic
1186872720 X:13788370-13788392 CAGAGCCAGTGGAAAGAGAGTGG + Intronic
1187278987 X:17842257-17842279 CAGACCCAGTGGACAGAGGGAGG + Intronic
1190853393 X:54268440-54268462 GAGTGCCAGTGGCAAGATCATGG - Intronic
1191714717 X:64186512-64186534 CAGGCCCAGTTGCTAGAGGGAGG - Exonic
1192208439 X:69111186-69111208 CAGGTCCACTAGCAAGAGGGAGG + Intergenic
1193241494 X:79175505-79175527 CAGAGTGAGTGGCAAGAGTGGGG - Intergenic
1193291370 X:79777106-79777128 ATGTGCCAGTGGCAGCAGGGTGG + Intergenic
1194131926 X:90092079-90092101 CAGTTCCTGGGCCAAGAGGGAGG - Intergenic
1194679599 X:96836059-96836081 CAGTGACAGAGGCCAGAGGCAGG - Intronic
1194893923 X:99415653-99415675 GTGTGCCAGTGGCAACAGAGTGG + Intergenic
1197789098 X:130233182-130233204 GATTGCCAGGGGCTAGAGGGAGG + Intronic
1198677239 X:139144097-139144119 CAGTGCCAGTGAGAACAGGAAGG - Intronic
1199684819 X:150256512-150256534 CAGTGCCAGTGGGAATTGGAAGG + Intergenic
1199999043 X:153047404-153047426 CAGTCCCAGTGACATGAGGGTGG - Intergenic
1200044227 X:153392512-153392534 CAGTGGCAGAGGAAAGTGGGAGG + Intergenic
1201754375 Y:17470153-17470175 CAGTTCCTGTCTCAAGAGGGAGG + Intergenic
1201847177 Y:18435832-18435854 CAGTTCCTGTCTCAAGAGGGAGG - Intergenic
1202369870 Y:24189221-24189243 CAGTGTCAATGGCCAGAGGTGGG - Intergenic
1202500914 Y:25480896-25480918 CAGTGTCAATGGCCAGAGGTGGG + Intergenic