ID: 1153857012

View in Genome Browser
Species Human (GRCh38)
Location 18:9159737-9159759
Sequence ATTAATAAATGGATGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 691
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 615}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153857012 Original CRISPR ATTAATAAATGGATGGTGAA GGG (reversed) Intronic
900081513 1:861849-861871 ATAAATAGATGGATGATGGATGG + Intergenic
900081529 1:862063-862085 ATAAATAGATGGATGATGGATGG + Intergenic
900498757 1:2989418-2989440 ATGGATAACTGGATGGTGGATGG - Intergenic
900573347 1:3370883-3370905 ATGGATGAATGGATGGTGGATGG - Intronic
900573359 1:3370946-3370968 ATGAATCGATGGATGGTGAATGG - Intronic
900573396 1:3371123-3371145 ATGAATCAATGGATGGTGAATGG - Intronic
900573426 1:3371253-3371275 ATGGATGAATGGATGGTGGATGG - Intronic
900573442 1:3371339-3371361 ATGAATGGATGGATGGTGAATGG - Intronic
900869373 1:5291003-5291025 ATTGATAGCTGGATGATGAATGG + Intergenic
900931027 1:5737700-5737722 ATATATGAATGGATGGTGGATGG + Intergenic
901001214 1:6149651-6149673 ATGGATAAATGGATGATGGATGG + Intronic
901006601 1:6174699-6174721 ATGGATGAATGGATGGTGGATGG + Intronic
901006723 1:6175299-6175321 ATGAATGAATGGATGGTGGATGG + Intronic
901006808 1:6175738-6175760 ATAGATAGGTGGATGGTGAATGG + Intronic
901006840 1:6175931-6175953 ATTGATAGGCGGATGGTGAACGG + Intronic
901777309 1:11569160-11569182 GTTAATAAATATATGGTGCATGG + Intergenic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
902790551 1:18764988-18765010 ATGAATGAATGCATGGGGAAGGG - Intergenic
903949724 1:26989207-26989229 ATAAATGAATGAATGGAGAAGGG + Intergenic
905493653 1:38365511-38365533 AAGAATGGATGGATGGTGAAGGG - Intergenic
907267856 1:53273756-53273778 ATTAAAAAACTGATTGTGAAAGG - Intronic
907423520 1:54363634-54363656 ATTAAAAAAATGATGGTGCAGGG - Intronic
907846991 1:58217977-58217999 TATAATAAATGCATGTTGAATGG - Intronic
908862437 1:68504877-68504899 TTTAATAAATATTTGGTGAAAGG + Intergenic
908927356 1:69271810-69271832 ATTAACAAATAAATGTTGAAGGG + Intergenic
909077918 1:71075335-71075357 TGTAATAAATGTATGGTGAGTGG + Intronic
909843298 1:80357049-80357071 TTTAATAAATTGAGGGTGCAGGG - Intergenic
910332509 1:86090508-86090530 AACAATAAATGTATGGTCAATGG - Intronic
911254525 1:95618828-95618850 TTTAATTCATAGATGGTGAAGGG - Intergenic
912283529 1:108343425-108343447 ATTGATATTTGTATGGTGAAAGG - Intergenic
913092368 1:115486122-115486144 AAAAATAAAGGGATGGAGAATGG + Intergenic
913179843 1:116311028-116311050 ATTGAGAACTGGATGGTGGATGG - Intergenic
913374562 1:118136421-118136443 ATAAATAAATGCATACTGAAAGG + Intronic
915116063 1:153600520-153600542 ATAAATAAATGGATGGTGGAGGG - Intergenic
915700155 1:157784439-157784461 TTTAATAAATGAATGGTGGGTGG + Intergenic
916242210 1:162651311-162651333 ATTAATAAATAGTTGGTGGGAGG - Intronic
916398345 1:164416813-164416835 CTTAATAAATGGTTGTTAAATGG - Intergenic
916499140 1:165371526-165371548 ATTAATAAATGCATGCTTAATGG + Intergenic
916767747 1:167878124-167878146 AATATTAAATGGTTGGTGATTGG + Intronic
917859696 1:179134478-179134500 ATAAATAACTTGATGGTGGAAGG - Intronic
921689697 1:218134138-218134160 ACTAGTAAATGGATGGCGAATGG + Intergenic
922745570 1:228041547-228041569 ATGAATTGATGGATGGTGGATGG - Intronic
922745795 1:228042926-228042948 ATGGATGGATGGATGGTGAATGG + Intronic
922790588 1:228308821-228308843 ATAAATAGATGGATTGTGGATGG - Intronic
924823740 1:247518690-247518712 ATTAATAATACGATGGGGAACGG + Intronic
1062837260 10:643747-643769 ATTTATCAATGGATGGTCATTGG - Intronic
1062940195 10:1415088-1415110 ACCAATGGATGGATGGTGAATGG + Intronic
1062943694 10:1444250-1444272 GGAAATAGATGGATGGTGAATGG - Intronic
1062943720 10:1444374-1444396 GTAGATAGATGGATGGTGAATGG - Intronic
1062973833 10:1668761-1668783 ATTTATTAATGGAAGGAGAAGGG + Intronic
1063887169 10:10591278-10591300 TTTAATAATGGGATGGTTAAAGG + Intergenic
1063934892 10:11067052-11067074 ACTAATAACTGGATGATGGAGGG - Intronic
1064496163 10:15912529-15912551 AGGAATAAATGAATGTTGAAGGG - Intergenic
1064826693 10:19411403-19411425 ATTAATAAATGTTTGCTTAATGG + Intronic
1064970906 10:21065868-21065890 ATTAACAAAGGGAGGGTGATGGG + Intronic
1065196642 10:23273041-23273063 ATTAATAAGTGAATGCAGAAAGG - Intronic
1065492879 10:26300045-26300067 CCTCATAAATGGATGATGAAAGG + Intronic
1065860770 10:29870778-29870800 ATGAATGGATGGATGGTAAATGG - Intergenic
1066035690 10:31481043-31481065 TTTAATAACTGGAAGGAGAATGG - Intronic
1066229330 10:33416895-33416917 ATGAATGGATGGATGGTGGATGG + Intergenic
1066553133 10:36581520-36581542 ACTAATAAATGTAAAGTGAACGG + Intergenic
1067202653 10:44186704-44186726 TTTAAAACATGCATGGTGAAGGG - Intergenic
1067342456 10:45416874-45416896 ATTGATGGGTGGATGGTGAATGG + Intronic
1068646031 10:59469479-59469501 TTAAGTAAATAGATGGTGAATGG + Intergenic
1068918078 10:62454722-62454744 CTTAATAAATGGTTGTTGCACGG - Intronic
1069220051 10:65871909-65871931 TTAAGTAAATGGATGGTGAATGG - Intergenic
1070219048 10:74421315-74421337 ATAAGTAAATGGATGATGAATGG + Intronic
1071509032 10:86249872-86249894 ATAAATGGATGGATGGTGGAAGG + Intronic
1072593445 10:96848682-96848704 AATAAAAACTGGATGCTGAAAGG + Intronic
1072698591 10:97622846-97622868 ATAAATAAATGAAAGATGAAGGG - Intronic
1074239067 10:111618832-111618854 GTCAATAAATGCATGTTGAATGG - Intergenic
1074957290 10:118404624-118404646 CTTGATAAATGGAAGGTGGAGGG + Intergenic
1075375080 10:121972446-121972468 ATAAATAAATGAAAGGGGAAGGG - Intronic
1075918320 10:126188945-126188967 GTGAATAGATGGATGATGAATGG - Intronic
1075918324 10:126188979-126189001 ATGGATGGATGGATGGTGAATGG - Intronic
1076929814 10:133524121-133524143 ATTAATAAATTAATGGGGGAGGG - Intronic
1077936795 11:6796583-6796605 ATTAGGAAATGGATGCTGGATGG + Intergenic
1077968863 11:7166298-7166320 ATTAAGCAATGGATGGAGGAAGG + Intergenic
1078017381 11:7626603-7626625 ATAAGTGAAAGGATGGTGAATGG + Intronic
1078410144 11:11107977-11107999 ATGTCTAAATGGATAGTGAAAGG + Intergenic
1078737839 11:14036978-14037000 ATGAATAAGTGGGAGGTGAAGGG + Intronic
1078800098 11:14634416-14634438 ATTAATAAATATTTGCTGAATGG + Intronic
1078820381 11:14874236-14874258 AAAAATAAAAGGATGGTTAAAGG - Intergenic
1078874013 11:15376004-15376026 TTTAATAAATGGACGTTTAAAGG - Intergenic
1079631754 11:22685862-22685884 ATTAAAAAATTTATTGTGAACGG + Intronic
1079955700 11:26861942-26861964 ATTAATAAATATTTAGTGAATGG + Intergenic
1080538168 11:33242711-33242733 ATTAATAGATGCATGGATAAAGG + Intergenic
1080547901 11:33339477-33339499 ATTAACAAAAGGATGGTTCAGGG - Exonic
1080791684 11:35527002-35527024 ATTAAGAAATGGAAGTGGAAGGG + Intronic
1080791767 11:35527766-35527788 ATTAAGAAATGGAAGTGGAAGGG - Intronic
1081261565 11:40967986-40968008 AGTAAGAAAGGGATGTTGAAAGG + Intronic
1081365771 11:42233291-42233313 AGTAATAAAAGGATGGTTATTGG - Intergenic
1081765852 11:45609654-45609676 ATGAATTCATGGATGATGAATGG + Intergenic
1081860056 11:46327956-46327978 ATGAATAAATGAATGATGAGAGG - Intergenic
1082747461 11:56980620-56980642 ATTAATAGATGGATGGGGATGGG + Intergenic
1082826014 11:57579442-57579464 ATTAATAAATGGGGGGAAAAAGG + Intergenic
1082987133 11:59178751-59178773 TTTAAGAAATGGATGGAAAATGG + Intronic
1083250229 11:61461860-61461882 ATGAATAAATGGGTGGAGAGAGG - Intronic
1083320556 11:61843433-61843455 ATAAATAAATGCAAGCTGAAAGG + Intronic
1083634616 11:64113723-64113745 ATTGATACATGGATGATGGATGG + Intronic
1083705836 11:64514571-64514593 ATAAATAAATGGGGGGAGAAGGG + Intergenic
1084057667 11:66646939-66646961 CTAAACAAATAGATGGTGAAAGG - Intronic
1084524956 11:69691072-69691094 ATTAATAAATTGTTGGATAAGGG + Intergenic
1084578059 11:70003568-70003590 CTTAATAAATTGTTGGTGGATGG + Intergenic
1084596273 11:70118788-70118810 ATGGATGAATGGATGCTGAAGGG + Intronic
1084615516 11:70233188-70233210 AGGAATAAAGGGATGCTGAAGGG - Intergenic
1084705134 11:70811703-70811725 ATGGATAAATGAATGGTGGATGG - Intronic
1084993456 11:72951785-72951807 ATTTATAAAGAGATTGTGAAAGG - Intronic
1086445477 11:86866496-86866518 ATGAATGAATAGATGATGAATGG - Intronic
1086985078 11:93238706-93238728 ATTTATGCAGGGATGGTGAATGG + Intergenic
1087052073 11:93896343-93896365 ATTAATAAATGTTTGAAGAATGG - Intergenic
1087226125 11:95601040-95601062 TTGAATGAATGGATGATGAAAGG + Intergenic
1087236301 11:95722624-95722646 TTAAGTAAATGGATGGTGTATGG + Intergenic
1087237792 11:95739377-95739399 ATTAAAAGACAGATGGTGAAGGG - Intergenic
1087349502 11:97013672-97013694 ATTAATAAATCATTGGTGATAGG - Intergenic
1087507371 11:99042986-99043008 ATAAAAGAATGGAAGGTGAATGG - Intronic
1088375027 11:109131623-109131645 ATGGATGAATGGATGGTTAAAGG + Intergenic
1088650869 11:111957236-111957258 ATTAATAAATGTAGGAGGAATGG + Intronic
1088866159 11:113849998-113850020 ATTAACAAAAGAATGGGGAAGGG - Intronic
1089427574 11:118392390-118392412 ATTCAAAAGTGGATGGAGAAGGG - Intronic
1089580055 11:119476096-119476118 ATGAATAGATGGATGGTGGGTGG + Intergenic
1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG + Intronic
1090377940 11:126304570-126304592 ATACATAAATGGATGATGAATGG - Intronic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1091194077 11:133717292-133717314 ATGAATGAATGAGTGGTGAATGG - Intergenic
1091405277 12:204787-204809 ATTAAGAACAGGATGGTGGAGGG - Intronic
1091519746 12:1225806-1225828 ATTCACAAATGCAAGGTGAAAGG + Intronic
1091654676 12:2337001-2337023 ATGGATGGATGGATGGTGAATGG - Intronic
1092440989 12:8502886-8502908 TTGAATAAATGAATGCTGAATGG + Intergenic
1092600656 12:10059529-10059551 ATTAAAAAATGGTTAATGAAAGG + Intronic
1093216738 12:16370576-16370598 ATTTATAACTTGATAGTGAAAGG + Intronic
1094178903 12:27569976-27569998 ATTATTAGAGGGATGGTAAATGG - Intronic
1094778384 12:33759256-33759278 ATTTATATTTGGATGTTGAAAGG - Intergenic
1095156632 12:38864300-38864322 GTAAATAAATGGATGATGATGGG - Intronic
1095414794 12:41965021-41965043 ATCAATTAATGCATGCTGAATGG - Intergenic
1096076115 12:48806027-48806049 ATTAATGAATGTTTGTTGAAAGG - Intergenic
1096611228 12:52803316-52803338 ATGAATAGATGGATGATGGATGG + Intergenic
1097299703 12:58005001-58005023 ATTAAAAAAGGGATGGGGAAGGG + Intergenic
1097415253 12:59307262-59307284 ATTGATAAATCGATGGTATATGG + Intergenic
1097694251 12:62761648-62761670 ATAAAAAAAGGGATGGAGAAGGG + Intronic
1097915995 12:65020957-65020979 GTTAATAATTTGATGATGAATGG - Intergenic
1098177641 12:67809511-67809533 ATAAATAAATGGATTAAGAAAGG + Intergenic
1098403591 12:70100010-70100032 ATTAGTAAATGGAGGGTGGATGG - Intergenic
1098849556 12:75579156-75579178 ATAAAGAAATGGAAGGTGAGAGG + Intergenic
1099123925 12:78728738-78728760 TTTTATCAAAGGATGGTGAAGGG + Intergenic
1099792441 12:87352813-87352835 ATTAATTAATGCATTTTGAATGG - Intergenic
1100033009 12:90215843-90215865 CTTAATAAATTTAAGGTGAAGGG - Intergenic
1100083724 12:90882003-90882025 ATAAGTAAATGGAGGGTGAGTGG + Intergenic
1100103162 12:91134566-91134588 AGTAATAAAAGGAGGGTCAAGGG - Intergenic
1100894844 12:99170029-99170051 AATAATGAATGTAAGGTGAAGGG - Intronic
1101140110 12:101786760-101786782 ATAAACAAATGGATGGGCAAAGG + Intronic
1101201302 12:102439193-102439215 ATGAATAAATGAATGGAGAAGGG + Intronic
1101801096 12:108022524-108022546 ATGAATGAATGGATGATGGAAGG - Intergenic
1102095889 12:110240997-110241019 AGTAGAAAATGGATGGTGTAGGG + Intergenic
1102222957 12:111206951-111206973 ATGCATAAATGGATGGTGGTTGG + Intronic
1102222970 12:111207046-111207068 ATGGATAAATGGATGGTGGTTGG + Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1103211730 12:119172067-119172089 ATCAATAAACGGATTGTAAAAGG - Intergenic
1103255955 12:119541445-119541467 ATGAATGAATGGATGGTGGATGG + Intergenic
1103403915 12:120661386-120661408 ATGAATAGATGCATGGGGAAGGG - Intronic
1104125996 12:125846666-125846688 TTCAGTAAATGGATGGTGCATGG - Intergenic
1104234242 12:126917575-126917597 ATTCCTAAATGAATGGGGAATGG - Intergenic
1104724722 12:131068713-131068735 ATAAATAAAAGGATAATGAATGG + Intronic
1104778669 12:131405624-131405646 ATTAATGAATGGATGATAGATGG - Intergenic
1106412452 13:29520061-29520083 ATTGATGGATGGATGGTGAGTGG - Intronic
1107320731 13:39185002-39185024 TTTAATAAATGGGTTTTGAATGG + Intergenic
1107521359 13:41185386-41185408 ATTACTAAAAGGAAGGAGAATGG - Intergenic
1109043339 13:57372694-57372716 TATTATAAATGAATGGTGAAGGG - Intergenic
1109045757 13:57409027-57409049 ATTAACAAAAGGAATGTGAAAGG + Intergenic
1109389422 13:61673074-61673096 ATTAAAAAATGCATGGCGTAAGG - Intergenic
1109638369 13:65153227-65153249 ATAAATAAAAGGATGGAAAAAGG - Intergenic
1109724163 13:66317059-66317081 ACAAATAAATGTATTGTGAAAGG - Intronic
1110576474 13:77062125-77062147 ATTAATAAGAAAATGGTGAAAGG + Intronic
1111168229 13:84491343-84491365 ATTAAAATATGGATGATGACTGG - Intergenic
1111642400 13:90985176-90985198 ATTCCTAAATAGATTGTGAAAGG + Intergenic
1112100131 13:96179473-96179495 ACTGATAAATACATGGTGAATGG - Intronic
1113852283 13:113424665-113424687 ATAGATGAATGGATGGTGAATGG - Intronic
1115068127 14:29290574-29290596 TTAAATAAATGGGTGGTGGAAGG + Intergenic
1115389053 14:32833185-32833207 TTTAATAAATGTTTGCTGAATGG - Exonic
1115464160 14:33696179-33696201 ATTAACAAATGAATAGTGACAGG - Intronic
1115772468 14:36679623-36679645 ATTAAAATATGTATGATGAAGGG - Exonic
1115977322 14:39011476-39011498 ATTAAAAAATGGATGGGTAGTGG - Intergenic
1116116227 14:40654467-40654489 ATAGGTAAATGGATGGAGAATGG + Intergenic
1116143942 14:41038974-41038996 ATTAATAAATTAATGGAGTAGGG - Intergenic
1116427204 14:44805946-44805968 ATTGATAGATGAATGGTTAAAGG - Intergenic
1116694447 14:48154492-48154514 ATTAATCAATGTATGATAAAAGG + Intergenic
1116811885 14:49547325-49547347 TTTAATATGTGGATGGTGGAGGG - Intergenic
1117058960 14:51941630-51941652 ATAAATAAATGGTTTGTTAATGG - Intronic
1118172349 14:63400091-63400113 AATGATAGATGGATGGTGGATGG - Intronic
1118279087 14:64412303-64412325 ATTAACAAGTGAATGATGAATGG + Intronic
1118393645 14:65317358-65317380 ATGAAGAAATGGATAGAGAATGG + Intergenic
1119661147 14:76452672-76452694 ATTATTAAAAGGATAGTGACTGG + Intronic
1119864756 14:77964220-77964242 CTTAATAAATGCCTGTTGAATGG + Intergenic
1119936425 14:78596281-78596303 TTTATTAAATGGTTAGTGAAGGG + Intronic
1120662660 14:87269238-87269260 ATAAAGAAATGGAAGGTGGATGG + Intergenic
1121264727 14:92593457-92593479 AACAGTAAATGGATGGAGAAAGG + Intronic
1121499772 14:94425466-94425488 ATCAGTAGATGGAGGGTGAAGGG + Intergenic
1122249974 14:100430921-100430943 AGGAATAAATCGCTGGTGAAGGG + Intronic
1122320045 14:100849825-100849847 AGTGATAAATGGATAGTTAAGGG + Intergenic
1122426810 14:101614427-101614449 TTAAGTAAATGGATGGTGGATGG + Intergenic
1123892554 15:24795865-24795887 ATTAATAAAGGGATGATAACTGG - Intergenic
1124531621 15:30513225-30513247 TTTAATCAGTGGATGGTGACAGG - Intergenic
1124767037 15:32494469-32494491 TTTAATCAGTGGATGGTGACAGG + Intergenic
1125473140 15:40024188-40024210 AAAAATAAAAGGATGGAGAAAGG - Intronic
1126226827 15:46280468-46280490 ATAAATTCATGGATGGTGGATGG + Intergenic
1127462804 15:59215109-59215131 ATCATTAAATGACTGGTGAATGG - Intronic
1128518929 15:68362633-68362655 ATGTATAGATGGATGATGAATGG + Intronic
1128903201 15:71444132-71444154 CTTAATAAATGCATGATGAATGG + Intronic
1128938202 15:71766150-71766172 ATTAAGAAATGAAAGGGGAAAGG + Intronic
1131804995 15:96112430-96112452 ATTGATAAAGAAATGGTGAATGG - Intergenic
1132019070 15:98344857-98344879 ATGAATGGATGGATGGTGGATGG + Intergenic
1132030935 15:98438084-98438106 ATGGATAGATGGATGATGAATGG + Exonic
1133144799 16:3776699-3776721 TTTTTTTAATGGATGGTGAAGGG - Intronic
1133544046 16:6787911-6787933 ATTACTAAACAGCTGGTGAAAGG + Intronic
1133563021 16:6967212-6967234 ATAAACAAATGGATGATGGATGG - Intronic
1133605603 16:7384880-7384902 ATTAATATATGGTTAGTGACAGG + Intronic
1133965929 16:10531777-10531799 ATGAATGAATGAATGGTGGATGG + Exonic
1134375479 16:13668650-13668672 AAGAATTAATGGATAGTGAATGG - Intergenic
1134554788 16:15155436-15155458 ATAAATGAATGGATGGGGAATGG - Intergenic
1134632237 16:15765161-15765183 ATGAATAAATGGATAGAGGATGG + Intronic
1137386087 16:48043926-48043948 ATTGATGGATGGATGGTGAATGG - Intergenic
1137386153 16:48044242-48044264 ATAGATGGATGGATGGTGAATGG - Intergenic
1138488045 16:57359267-57359289 TTTAAAAAATGGATGGTGGGAGG - Intronic
1138495739 16:57408159-57408181 ATTGGTGGATGGATGGTGAAAGG - Intronic
1139129722 16:64127053-64127075 ATTAATAAAAGTATGCTGACTGG + Intergenic
1139450269 16:67023823-67023845 ATGAATAAATGGATGCTGTGGGG + Intergenic
1140100349 16:71910905-71910927 ATATATAAATGCATGGAGAAGGG - Intronic
1140152912 16:72390169-72390191 ATTAATCTATGGATAGTGGAAGG - Intergenic
1140297778 16:73725964-73725986 TTTATTTAATGGATGGTGAAAGG - Intergenic
1141110087 16:81265258-81265280 ATGAATGGATGGATGGTGAGTGG - Intronic
1141110129 16:81265418-81265440 ATGAATGGATGGATGGTGGATGG - Intronic
1141110182 16:81265620-81265642 ATGAATGGATGGATGGTGGATGG - Intronic
1141742890 16:85905843-85905865 CGTAATAAGTGGATGGTAAAAGG + Intronic
1143073277 17:4316497-4316519 ATTAATTAATGGAAGGTTGAAGG - Intronic
1144288500 17:13803106-13803128 TTTAATAAAATGAAGGTGAAAGG - Intergenic
1144364574 17:14530051-14530073 ATTTAGAAATGGGTGGTGAGTGG - Intergenic
1146380576 17:32324223-32324245 ATTAAAAAACGAATGATGAATGG - Exonic
1146670582 17:34734691-34734713 CTTAATAAATGTCTCGTGAATGG - Intergenic
1147057005 17:37842659-37842681 ATTATTAAATCAATGGTGCAGGG + Intergenic
1147977473 17:44256009-44256031 AATAATCAATGGATGATCAATGG - Intronic
1148532704 17:48410151-48410173 TTAAGTAAATGGATGATGAATGG + Intronic
1148632354 17:49121058-49121080 CTCAATAAATGTATGTTGAAAGG - Intergenic
1149175859 17:53868998-53869020 TTGTATAAATGGATGGTGAGTGG + Intergenic
1149865540 17:60149268-60149290 ATTAAGAAATGGATTGTAAGAGG - Intergenic
1150204724 17:63394340-63394362 ATTAATAGAGGGAAGTTGAAAGG - Intronic
1150392281 17:64796911-64796933 ATAGATAGATGGATGGTGGATGG - Intergenic
1151075525 17:71267919-71267941 ATTAAGATATGAGTGGTGAATGG + Intergenic
1152301818 17:79499276-79499298 ATGAATAAATGGATGGTAGATGG - Intronic
1152301845 17:79499465-79499487 ATGAATGAATGGATGGTGGATGG - Intronic
1152314054 17:79569813-79569835 AATTATGGATGGATGGTGAACGG + Intergenic
1152314084 17:79570035-79570057 AATTATGGATGGATGGTGAATGG + Intergenic
1153012317 18:550060-550082 CTTGAAAAAAGGATGGTGAAGGG - Intergenic
1153319389 18:3757420-3757442 ATAAATAAATAAATGGTGCAAGG + Intronic
1153857012 18:9159737-9159759 ATTAATAAATGGATGGTGAAGGG - Intronic
1154956726 18:21265448-21265470 ATGAAAAAATGGACGGTGATGGG + Intronic
1155491085 18:26402629-26402651 ATTAATAGATTGATGTTGCAGGG - Intergenic
1155664081 18:28285917-28285939 ACTCATAAAATGATGGTGAAAGG - Intergenic
1155676309 18:28433289-28433311 TTTAATAAATAGATGGTGCTGGG - Intergenic
1155793343 18:30001693-30001715 ATTTACAAATGGATGGTGGGTGG - Intergenic
1156424377 18:36993470-36993492 ATTAAAAGTTGGATAGTGAAGGG + Intronic
1156471604 18:37380535-37380557 ATGGATAGATGGATGGAGAATGG - Intronic
1158360572 18:56667837-56667859 TTTAATAAATATATGGTGAAGGG - Intronic
1158849898 18:61485221-61485243 GTTAATACATTGATGGTGTATGG - Intronic
1159336211 18:67070742-67070764 ATGAATAAATGAATGAAGAAGGG - Intergenic
1159678019 18:71310437-71310459 AATACAAAATGGATGGTGTAAGG + Intergenic
1160098773 18:75901316-75901338 ATTAAAAACCAGATGGTGAAAGG + Intergenic
1160185938 18:76676146-76676168 ATTGTTAAATGGATGTTGATGGG - Intergenic
1160328845 18:77974096-77974118 ACCAAAAAATGGATGGTGGATGG + Intergenic
1160502432 18:79408802-79408824 ATGAATGAATGGATAGGGAATGG - Intronic
1160502455 18:79408928-79408950 ATGAATGAATGGATAGGGAATGG - Intronic
1160502478 18:79409057-79409079 ATGAATGAATGGATAGGGAATGG - Intronic
1160502523 18:79409313-79409335 ATGAATGAATGGATAGGGAATGG - Intronic
1160526684 18:79542682-79542704 ATGAATGCATGGATGATGAATGG - Intergenic
1161633118 19:5369339-5369361 ATGAATAGATGGATGATGGATGG - Intergenic
1161933779 19:7358321-7358343 ATGGATGAATGGATGTTGAATGG - Intronic
1162089056 19:8266431-8266453 CTTAATAAATGCATGAAGAAAGG + Intronic
1162424743 19:10587660-10587682 ATGAAGAAATGGATGACGAATGG - Intergenic
1162852322 19:13440318-13440340 ACTAATAAGTTGAAGGTGAAAGG - Intronic
1162875225 19:13616399-13616421 ATGAATGAATGAATGATGAATGG - Intronic
1163894173 19:20042721-20042743 ATTAATAAAGGGATGGGAAATGG - Intergenic
1164046122 19:21543612-21543634 ATTACTAGAGGGATGGGGAAGGG + Intronic
1164569670 19:29364072-29364094 ATGAATAAGTGGATGGAGAGAGG + Intergenic
1165190325 19:34057497-34057519 ATGGATAAATGGATGATGGATGG + Intergenic
1165431086 19:35773613-35773635 ATTAAGCAAGGGCTGGTGAAAGG - Intergenic
1165569609 19:36764408-36764430 AAAAATAAATGTCTGGTGAAAGG + Intronic
1166008220 19:39921996-39922018 ATTAATAATCAGTTGGTGAAAGG - Intronic
1166201456 19:41240169-41240191 ATAAATGACTGGATGGTGAGTGG + Intronic
1166458415 19:42964486-42964508 ATAAGTAAATGGCTGGTGACTGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167101730 19:47407794-47407816 ATAAATAAATGGATAGGGAGAGG - Intronic
1167153602 19:47724593-47724615 ATGAGGAAATGAATGGTGAAAGG + Intronic
1167401240 19:49271780-49271802 GTTAATAAATGAATGGTTATTGG - Intergenic
1168635882 19:57996510-57996532 ATAAATAAATGGCTGGTAAGGGG + Intronic
925430894 2:3791965-3791987 ACTAATAAATGAATGGCCAAAGG - Intronic
925614029 2:5728457-5728479 ATCAATGAATGGATGATGGATGG + Intergenic
926213980 2:10892432-10892454 ATTGATGGATGGATGGTGGATGG - Intergenic
926302788 2:11616512-11616534 ATGAGTAAATGGATGGGGAGAGG + Intronic
927654184 2:24931505-24931527 ATTAATAAATGCTTGGAGGAAGG + Intergenic
927712608 2:25335242-25335264 ATAAATAAATGCATGGGTAAAGG - Intronic
927839711 2:26432111-26432133 ATTAATAAATACGTGCTGAAGGG - Intronic
928898255 2:36290131-36290153 ATTTATTAATGGCTGGTTAATGG + Intergenic
929680900 2:43992668-43992690 ATCAATAAATGGGGGGTGAAGGG + Intronic
930058515 2:47270286-47270308 CTCAATAAATGTATGATGAATGG + Intergenic
930669278 2:54131351-54131373 ATCAATGAATAGATGGTGGAAGG + Intronic
930791845 2:55340742-55340764 ATTTATAAAGGGATAATGAATGG - Intronic
931169179 2:59784511-59784533 ATGAATGGATGGATGGTGAATGG + Intergenic
931169181 2:59784538-59784560 ATGAATAGATGGATGATGAATGG + Intergenic
931239015 2:60436029-60436051 ATTAATGAGGGGATGGGGAAGGG - Intergenic
931593182 2:63909313-63909335 ATGAATAAATGAATGGTGGTTGG + Intronic
931911772 2:66907370-66907392 CTTAATAAGTGAATGCTGAATGG - Intergenic
932642099 2:73459535-73459557 ATAAATAAATAAATGGAGAAGGG - Intronic
932927887 2:75997833-75997855 ATTTATAAATAAATGGTTAAGGG - Intergenic
933112362 2:78419736-78419758 ATTAAGTAATGTATGGTGAATGG + Intergenic
933238709 2:79895630-79895652 ATTAGTAACTGGATGATCAATGG - Intronic
933997593 2:87681139-87681161 AGGAATAAATGAATGATGAATGG - Intergenic
934019689 2:87934121-87934143 ATTTTTAAATGGATGGGAAATGG - Intergenic
934647005 2:96064745-96064767 ATGAATGAATGGATGGTAGATGG - Intergenic
934840380 2:97620621-97620643 ATGAATGAATGGATGGTAGATGG - Intergenic
935529050 2:104210524-104210546 ATAAATAAATGAATGGATAAAGG - Intergenic
935731560 2:106068182-106068204 ATTAATAAATTGATCAAGAAGGG - Intronic
935782255 2:106518670-106518692 AGGAATGAATGGATGGTGAATGG - Intergenic
936296259 2:111269731-111269753 AGGAATAAATGAATGATGAATGG + Intergenic
936536480 2:113315538-113315560 ATCAATTAAGGGATGTTGAAGGG + Intergenic
936563150 2:113559584-113559606 AAAAATAAATGAATGATGAATGG - Intergenic
936563256 2:113560420-113560442 AATAATGAATGCATGATGAATGG - Intergenic
938968855 2:136413429-136413451 ATTTATAAATGGATAGTGATGGG - Intergenic
939025989 2:137014340-137014362 CATAATAAATGTATTGTGAATGG + Intronic
939562383 2:143747770-143747792 ATAAATGAATGGATAATGAATGG - Intronic
939670819 2:145009769-145009791 ATTAATAAATGCATGATGTTTGG + Intergenic
939679296 2:145110468-145110490 ATGAATAAATAGATGATGAATGG + Intergenic
940745317 2:157561179-157561201 ATTAATAAAAGGAGGGGGATTGG - Intronic
941025281 2:160449838-160449860 ATTAAAAAATGGGGGATGAATGG + Intronic
941750662 2:169132087-169132109 ATGAATAGATGGATGATGAATGG + Intronic
943433415 2:187832680-187832702 ATTAATAAATGGATTATCAAAGG + Intergenic
944640772 2:201723322-201723344 CTTAATAAAATGATGGTGAGTGG - Exonic
945792882 2:214327127-214327149 CTTAAAAACTGGATGCTGAAAGG - Intronic
945855954 2:215070269-215070291 ATTATTGAATAGATGGCGAATGG - Intronic
945977654 2:216283255-216283277 ATGAATAAATGAATGCAGAAAGG - Intronic
946693772 2:222332139-222332161 CTTTATAAAAGGAAGGTGAAGGG - Intergenic
948558041 2:238830453-238830475 ATAAATAAATAAATGGGGAAGGG + Intergenic
949065782 2:241989704-241989726 ATTGATGGATGGATGGTGGATGG - Intergenic
949065798 2:241989774-241989796 ATGGATGAATGGATGGTGGATGG - Intergenic
1169197435 20:3691117-3691139 AGAAATAAATGGCTGGTGCAGGG - Intronic
1170109527 20:12789994-12790016 AGTAATAAATAGATTGTGAAAGG - Intergenic
1170956595 20:20985636-20985658 ATGAATGAATGAATGGTGAATGG - Intergenic
1171069793 20:22057570-22057592 ATGAATAAATGGTGGATGAATGG + Intergenic
1171154447 20:22859415-22859437 ATTTAGAAATGGATGGTATATGG - Intergenic
1171478466 20:25433029-25433051 ATTAATAGATTGAAAGTGAAAGG - Intronic
1171940270 20:31322267-31322289 ATAAATAAATGTATTGTCAAGGG - Intergenic
1172757148 20:37293672-37293694 TTAAGTAAATGTATGGTGAATGG - Intronic
1173063507 20:39684612-39684634 ATAAATGAATGAATGGTGTATGG + Intergenic
1173379654 20:42528442-42528464 TCTAATAAATGGATAATGAATGG + Intronic
1173405483 20:42760839-42760861 ATTAATAATAGAATGGAGAAAGG - Intronic
1174666452 20:52262502-52262524 GGTAATAAATGTTTGGTGAAGGG - Intergenic
1174940004 20:54916434-54916456 ATTAATGAATGAATGGTGGATGG - Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175221207 20:57417525-57417547 ATGGAGAAATGGATGGGGAATGG + Intergenic
1175325471 20:58124489-58124511 TTAAGTAAATGAATGGTGAATGG + Intergenic
1175559509 20:59908826-59908848 TTTCATAAATTGATGGTGAAGGG - Intronic
1175659532 20:60800478-60800500 ATAAGTAAATGGATAGTGGATGG + Intergenic
1175688001 20:61045319-61045341 ATGCATGGATGGATGGTGAAAGG - Intergenic
1175817282 20:61889859-61889881 ATGGATAGATGGATGGTGGATGG + Intronic
1175817391 20:61890448-61890470 ATGGATAAATGGATGATGGAAGG + Intronic
1178368634 21:32008836-32008858 ATGGATGGATGGATGGTGAATGG + Intronic
1179125936 21:38590644-38590666 ATGAATACATGGATGATGGATGG - Intronic
1181130436 22:20728437-20728459 TTTAAGACAAGGATGGTGAAAGG - Intronic
1181824873 22:25507028-25507050 ATGAATAAAAGGATGGGGGATGG - Intergenic
1181824894 22:25507149-25507171 ATGAATAAAAGGATGGAGGATGG - Intergenic
1182227992 22:28814828-28814850 ATGAATGAATGGAAGATGAATGG + Intergenic
1182970521 22:34570434-34570456 TTAAGTAAATGGATGGTGGATGG - Intergenic
1182995791 22:34810830-34810852 TTTAATAAATGGGTGGTAAATGG + Intergenic
1183303944 22:37072028-37072050 ATGAATGGATGGATGGTGGATGG + Intronic
1184460243 22:44633795-44633817 ATGAGTAGATGGATGATGAATGG + Intergenic
1184942726 22:47780947-47780969 ATTAATTAATGGATGGTTGGAGG + Intergenic
1185104407 22:48859118-48859140 ATTGATGAATGGATGATGAAAGG - Intergenic
1185108523 22:48887690-48887712 ATGAATGGATGGATGGTGGATGG - Intergenic
1185154565 22:49185410-49185432 ATGGATGGATGGATGGTGAATGG - Intergenic
1185193381 22:49452836-49452858 ATGAATAGATGGATCATGAATGG + Intronic
1185196851 22:49477040-49477062 ATGAATAGATGGATGGTAAATGG + Intronic
1185306237 22:50118628-50118650 ATTAATAGGTGGTTGGTGGAAGG + Intronic
949275847 3:2280102-2280124 AAAAATAAATGCATGTTGAATGG - Intronic
949612009 3:5712419-5712441 AGGAAGAAATGGATGCTGAAAGG - Intergenic
950177750 3:10887198-10887220 AATGATAAATGGATAATGAATGG + Intronic
950840837 3:15966843-15966865 ATTATAAAATGGATTGTGTATGG + Intergenic
950858670 3:16128437-16128459 ATTAATAAAAAGATCTTGAAAGG + Intergenic
951927194 3:27921448-27921470 ATGAAAAAATGCATGCTGAATGG - Intergenic
952206922 3:31189537-31189559 ATGAATGAATGAATGATGAATGG + Intergenic
952978548 3:38716875-38716897 ATGGATGAATGGATGATGAATGG + Intronic
953255993 3:41290968-41290990 ATTAGTAAATGGCTGGTGTGAGG + Intronic
953397325 3:42583429-42583451 ATAAATGGATGGATGGTGCAGGG + Intronic
953701603 3:45200213-45200235 ATTCTTAACTGGATGGTGATTGG - Intergenic
954043479 3:47908732-47908754 ATTAAGAAATGGATGATGATAGG + Intronic
954736044 3:52707149-52707171 ATAAATAAATAAAAGGTGAAGGG - Intronic
955993153 3:64650150-64650172 ATTAGTAAATGTTTGCTGAAGGG + Intronic
956963918 3:74436190-74436212 ATTAGTAAATGTAAGTTGAAAGG - Intronic
957243661 3:77691119-77691141 ATCATTAAATGGATGGAGTAGGG - Intergenic
957588385 3:82162019-82162041 ATTAAGAAATGAATGGAAAAAGG - Intergenic
957609066 3:82443937-82443959 ATAAATAAATAGATGTTAAAGGG + Intergenic
958121199 3:89291094-89291116 ATTAATGAATGAATGCAGAAAGG + Intronic
958182462 3:90077583-90077605 ATTAAGAAATGAATACTGAAGGG - Intergenic
958433607 3:94071451-94071473 ATTTTTAAATGGATGATGATGGG + Intronic
958984505 3:100764406-100764428 CTTAATAAATGTTTGCTGAATGG + Intronic
959179857 3:102964424-102964446 TTTAATAAATGTATGGCTAAGGG - Intergenic
959301257 3:104604983-104605005 ACTAATAAAAAGATGTTGAAAGG + Intergenic
959655241 3:108796820-108796842 ATCAAGTAATGGATGGTAAAAGG + Intergenic
959864936 3:111255338-111255360 ATTAATAAATGGAGAGGGATAGG - Intronic
962611098 3:137076870-137076892 ATTAAAAAATGGAGTCTGAATGG + Intergenic
963346929 3:144106067-144106089 TTTAAAAATTGGATGGAGAAGGG - Intergenic
963451325 3:145484786-145484808 AGTTATAAATGGCTGGAGAAAGG + Intergenic
963651268 3:147983593-147983615 ATTAATTATTTGATGGTGTATGG + Intergenic
963705444 3:148681305-148681327 ATGAATGAATGCATTGTGAAAGG - Intergenic
963924476 3:150937127-150937149 TTTAAGAAATGTCTGGTGAAAGG + Intronic
965144193 3:164877991-164878013 ATTAAACAATGTATGCTGAATGG - Intergenic
965162652 3:165154376-165154398 CTAAGTAAATGGATGGTGGATGG + Intergenic
965690020 3:171345927-171345949 ATGAATGAATGAATGATGAATGG + Intronic
965887360 3:173463515-173463537 ATTAATAAATGAATGATAATTGG - Intronic
967423184 3:189296760-189296782 ATAAATAAATGGAGAGTGACAGG + Intronic
967913590 3:194561783-194561805 GTTAAGAAATGGATGGAGCATGG + Intergenic
967948753 3:194824232-194824254 ATGAATGAATGAATGGTGACTGG + Intergenic
967954175 3:194864727-194864749 CTAAATGAAAGGATGGTGAAGGG + Intergenic
969206531 4:5651409-5651431 ATGAGTAAATGGATGATGGATGG + Intronic
969383915 4:6830188-6830210 AATAATAACAGGATGGTGTAAGG - Intronic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969510330 4:7614090-7614112 ATGGATGAATGGATGGTGATGGG - Intronic
969510521 4:7614940-7614962 ATGGGTGAATGGATGGTGAATGG - Intronic
969510728 4:7616338-7616360 ATGAATAGGTGGATGGTGGATGG - Intronic
969510736 4:7616373-7616395 ATGGATGAGTGGATGGTGAATGG - Intronic
969528492 4:7716520-7716542 ATGAATAGATGGATGGTGGATGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
969599379 4:8166933-8166955 ATAGGTGAATGGATGGTGAATGG - Intergenic
970064300 4:12074355-12074377 ATGAATAGAGGGATGGTGTAAGG - Intergenic
971006988 4:22386091-22386113 ATGAATAAATGCTTGCTGAATGG + Intronic
971459174 4:26875915-26875937 AATAATAAAAGGATGATAAATGG - Intronic
971811726 4:31436551-31436573 ATAATTAAATGGATGGAAAATGG + Intergenic
971819632 4:31534553-31534575 ATCAGTAAATGGATGGTAAATGG - Intergenic
971823758 4:31594454-31594476 ATAATTAAATGAATGGTGACTGG - Intergenic
972433366 4:39006603-39006625 ATTAAGAAATGAAATGTGAAAGG - Intronic
972464671 4:39343578-39343600 ATTTATAAATGCATGGTGCAGGG - Intronic
973117201 4:46476551-46476573 ATAAATAAATGCATGGAGATAGG - Intergenic
973902364 4:55489033-55489055 ATGGATAAATGGATAGTGTAAGG - Intronic
974561475 4:63527214-63527236 AATAGCAAATGGAAGGTGAATGG + Intergenic
974806825 4:66891457-66891479 ATGAATAAATGCTTGTTGAATGG + Intergenic
974861184 4:67523458-67523480 ATAAGTAAATGGATGTTGAATGG + Intronic
975349384 4:73328763-73328785 ATTAATAAGAGAATGGTGAAAGG - Intergenic
975839405 4:78457607-78457629 ATTAGTAAATAGCTGATGAAAGG - Intronic
976776257 4:88709385-88709407 ATTATTAAATGTTTGTTGAATGG - Intergenic
976865516 4:89721735-89721757 ATTTATAAATAGATAGTAAAGGG - Intergenic
977179117 4:93852196-93852218 GTTAATAGATGGCTGGGGAATGG - Intergenic
977720489 4:100234915-100234937 ATTTATCAATGGATTGTAAAAGG + Intergenic
978009303 4:103659297-103659319 ATTCATAAATGTCTGTTGAATGG + Intronic
978253178 4:106658175-106658197 ACTAATAAATGGATGGCAAGTGG - Intergenic
978270821 4:106887935-106887957 ATAACTAAATGACTGGTGAACGG + Intergenic
979188745 4:117832194-117832216 ATTAAAATATGGATGATGATCGG + Intergenic
979299554 4:119070837-119070859 CTTAATAAAAGGCTGATGAAAGG + Intergenic
979569590 4:122203210-122203232 ATTAATAAATGGTATGAGAATGG - Intronic
979580785 4:122357264-122357286 ATTAAGAAATGTATGGTGGCTGG + Intronic
979602609 4:122603149-122603171 ATTAATAAATCCATCCTGAAGGG - Intergenic
979633156 4:122925891-122925913 ATGAATAAATGAAGGGTGGATGG + Intronic
979857645 4:125653310-125653332 ATTATAAAATGGATTGTGAGAGG + Intergenic
980017704 4:127672094-127672116 TTTAATAGATGGATGTTGCATGG - Intronic
980249315 4:130293735-130293757 AATGATAAATGGATGAAGAATGG + Intergenic
981002967 4:139845714-139845736 CTTTATAAATCTATGGTGAATGG + Intronic
981818234 4:148855770-148855792 TTTAATAGATGGATGATAAATGG - Intergenic
983048629 4:163017403-163017425 ATTAAGTAATGGATGGTGAATGG + Intergenic
983649120 4:170020952-170020974 ATTAATGAATGGATGGAATATGG + Intronic
983744335 4:171177139-171177161 ATTTATAAAATGATGGTGAGAGG + Intergenic
983770266 4:171540167-171540189 ATGGATAGATGGATGGTGGAAGG - Intergenic
983880513 4:172927058-172927080 ATCATTAAATGGATGGGGACGGG - Intronic
985256988 4:188080124-188080146 ATTAGCAAAGTGATGGTGAATGG - Intergenic
985376537 4:189346008-189346030 ATTATTAAAATGATGTTGAAGGG - Intergenic
985829711 5:2219413-2219435 ATGAATGGATGGATGTTGAATGG - Intergenic
986072879 5:4304430-4304452 ATGAATAGATGGATGATGGATGG - Intergenic
986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG + Intergenic
986413919 5:7509235-7509257 ATGAATGCATGCATGGTGAATGG + Intronic
987430225 5:17823984-17824006 ATTACTCAATGGATGCAGAAAGG + Intergenic
987519044 5:18954461-18954483 ATGAATGAATGGAAAGTGAAAGG + Intergenic
987794958 5:22615811-22615833 GATAATGAATGTATGGTGAATGG + Intronic
987920160 5:24269786-24269808 ATAAATAAATAGATCATGAAGGG - Intergenic
988060245 5:26158334-26158356 ACAAGTAAATGGATGGTGGATGG - Intergenic
988641739 5:33048324-33048346 ATTTTTCCATGGATGGTGAAGGG + Intergenic
989265861 5:39472962-39472984 ATTAATAAATATATGTTGAATGG - Intergenic
989744802 5:44816110-44816132 ATCAATAAATGTTTGTTGAATGG + Intronic
989760571 5:45011398-45011420 ATATATATATGCATGGTGAAAGG - Intergenic
990496794 5:56356207-56356229 TTTAATAAATGCATATTGAATGG + Intergenic
993604428 5:89970871-89970893 TTTTATAAATGTAAGGTGAAGGG - Intergenic
993748598 5:91635286-91635308 AATAATAATTAGCTGGTGAAAGG - Intergenic
993849455 5:92988735-92988757 TTAAATAAATAAATGGTGAATGG + Intergenic
993978014 5:94506144-94506166 TTTAAAAAATTGATTGTGAAAGG - Intronic
994922050 5:106058774-106058796 ATGAATAAATGGATAAAGAATGG + Intergenic
995089539 5:108157246-108157268 ATAAATAAATGAAAGGGGAAAGG + Intronic
996068452 5:119106810-119106832 ATGAATTAATGAATAGTGAAAGG + Intronic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996380423 5:122857382-122857404 ATAAATAAATAAATGATGAAGGG - Intronic
997240083 5:132300521-132300543 ATTAATAAATAGATGTGGAGGGG - Intronic
997529637 5:134573897-134573919 CCTACTAATTGGATGGTGAAGGG - Intronic
998601948 5:143593512-143593534 ATAAATAAATGAATGATGCATGG - Intergenic
998725928 5:145014795-145014817 ATTAGCAAATGGATGTTGATTGG - Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999105238 5:149064719-149064741 ATTCATAAATGGTGGGAGAAGGG - Intergenic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
1000165092 5:158640531-158640553 ATTAATAACTGGATGGTAGGAGG + Intergenic
1001646256 5:173284368-173284390 ACGAATAGATGGATGGTGGATGG - Intergenic
1001865673 5:175102995-175103017 ATGAATGGATGGATGATGAATGG + Intergenic
1002511329 5:179720406-179720428 ATGAAGACATGGATGGAGAATGG + Exonic
1004561363 6:16754651-16754673 TTAAATAAATGCTTGGTGAATGG - Intronic
1004794947 6:19071004-19071026 ATTAATATATAAATGGAGAAAGG + Intergenic
1005915328 6:30345879-30345901 CTTAATAAATGAATGGTGATGGG - Intronic
1006387105 6:33737376-33737398 ATTAATAACTCGGTGGTGACAGG - Intronic
1006558800 6:34891025-34891047 CTAAATAAATGGATGGTGGATGG + Intronic
1006809296 6:36809754-36809776 ATTAGGAAATGGATGCTGACGGG + Intronic
1007769514 6:44181306-44181328 CTCAAGAAATGGATGGTAAAGGG + Exonic
1007874898 6:45085792-45085814 ATTAATAAGTAGTTGATGAATGG + Intronic
1007969814 6:46040026-46040048 ATTAGAAAATGGATGCTGAGAGG - Intronic
1008206258 6:48662007-48662029 ATTAATAAATGTAGAGGGAATGG - Intergenic
1009427697 6:63532585-63532607 TTTAATAAGGGGATAGTGAATGG - Intronic
1009553271 6:65127735-65127757 ATGAAGAAATGGATACTGAAGGG - Intronic
1009747090 6:67830965-67830987 ATAAATAAGTGGATGGTTGAAGG + Intergenic
1010174243 6:73007951-73007973 ATTAATAACTGAAAGGTGTAGGG + Intronic
1010487309 6:76430881-76430903 ATTCCTAAAAGGATGGAGAAAGG + Intergenic
1010688672 6:78881808-78881830 ATAAATAAGTGGATAGTGGATGG + Intronic
1011110797 6:83834957-83834979 ATTAATAAATGTTTGTTGAGGGG - Intergenic
1011609405 6:89135907-89135929 ATAAGTATATGGATAGTGAAGGG - Intergenic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1013818584 6:114129022-114129044 TTTAATAAATGTATGATAAATGG - Intronic
1015010746 6:128344258-128344280 AGTATTAAGTGGATGGTGAGAGG - Intronic
1015553313 6:134434886-134434908 ATAAATGAGTGGATGGTGGATGG + Intergenic
1015638623 6:135305993-135306015 AGCAATAAAAGGATAGTGAAGGG - Intronic
1015875416 6:137817425-137817447 AGTAATACAGGGATGGGGAAGGG + Intergenic
1015952194 6:138564612-138564634 CTCAATAAATGGTTGCTGAATGG - Intronic
1016232782 6:141826973-141826995 ATTAATAAATGGAAAGTTAGGGG - Intergenic
1016255711 6:142102757-142102779 CTTGATAAATGGAAGATGAAGGG - Intergenic
1016556254 6:145341622-145341644 AGTGAGAGATGGATGGTGAATGG - Intergenic
1017677177 6:156826495-156826517 CTTAGTAAATGTGTGGTGAATGG + Intronic
1018364376 6:163103000-163103022 ATTAATAAATATTTGCTGAATGG + Intronic
1019327000 7:443437-443459 ATGGATGGATGGATGGTGAATGG + Intergenic
1019327066 7:443727-443749 GTGAATAGATGGATGGTGGATGG + Intergenic
1019555833 7:1630894-1630916 ATAAATGGATGGATGGTGGATGG - Intergenic
1020365839 7:7379665-7379687 ATGAATAAATGAATGGAGAAAGG + Intronic
1020763642 7:12295621-12295643 ATTATTACAGGGATGGTGACAGG - Intergenic
1021509118 7:21416194-21416216 ATCAATAAATGGATGTTGGCAGG - Intergenic
1021730368 7:23589765-23589787 ATAAATAAATAAATAGTGAATGG - Intergenic
1022594003 7:31694550-31694572 TGCAATAAATGGATGTTGAACGG - Intronic
1023204652 7:37734784-37734806 ATTAGTAGATGGATGGGGAGGGG + Intronic
1023765427 7:43505940-43505962 ACTAATAAATGGTTATTGAATGG + Intronic
1024170841 7:46784036-46784058 ATGAATAAATGAATGTAGAAGGG + Intergenic
1025116045 7:56259183-56259205 ATGGATAGATGGATGATGAATGG + Intergenic
1026275192 7:68870244-68870266 ATGAATGGATGGATGATGAATGG + Intergenic
1026353768 7:69539880-69539902 AGTAACAAAGGGATGGGGAAGGG - Intergenic
1026371359 7:69702876-69702898 TTCAATAAATGTTTGGTGAATGG - Intronic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1028285987 7:89000359-89000381 ATTAAGCAATGAATTGTGAAAGG + Intronic
1028655915 7:93206847-93206869 GTTGATAAATGTATAGTGAATGG - Intronic
1030167338 7:106568571-106568593 AAAAATAAATGGATGGTGGGGGG + Intergenic
1030523189 7:110623225-110623247 ATTATTAGAGGAATGGTGAATGG - Intergenic
1030627005 7:111855234-111855256 GCTAATAGATGGGTGGTGAAAGG + Intronic
1031224173 7:119013365-119013387 ATCAATAAATGTTTGTTGAATGG + Intergenic
1031315536 7:120253831-120253853 CTCAATAAATGTATGGTGAAAGG + Intergenic
1031900667 7:127406708-127406730 ATTAGTACAGGTATGGTGAAAGG + Intronic
1032549929 7:132775529-132775551 ATTAATAAATAAAAGGAGAAAGG - Intergenic
1032887783 7:136161044-136161066 AATAATAAATTGATGTTAAAAGG - Intergenic
1033113614 7:138605717-138605739 TCTCATAAATGGATGGTGACTGG - Intronic
1033301984 7:140194787-140194809 ATAAAGAAATGGGAGGTGAAAGG + Intergenic
1033477896 7:141708321-141708343 ATTTATAAATGGCAGGTGTAAGG + Intergenic
1033958056 7:146876589-146876611 TTTAATAAATGGTTGTTGAATGG - Intronic
1034883631 7:154780968-154780990 ATGAATAGATGGATGGTTGATGG + Intronic
1035005677 7:155658316-155658338 ACTAATAAATTGAAAGTGAAAGG - Intronic
1035452727 7:158988738-158988760 ATGAATGAATGCATGATGAATGG - Intergenic
1035523738 8:295484-295506 ATAAATAGATGGATGATGGATGG - Intergenic
1038325132 8:26567250-26567272 ATAAATGAATGGGTGGTGGATGG - Intronic
1039337843 8:36612504-36612526 AATAATAAATGAATGGGGGAAGG - Intergenic
1039376317 8:37037765-37037787 ATGAAGAAATGGAGGCTGAAAGG + Intergenic
1040797424 8:51301093-51301115 ATTAATATAATAATGGTGAAAGG + Intergenic
1041413749 8:57584678-57584700 ATGAATGAATGAATGGAGAACGG + Intergenic
1041424920 8:57709701-57709723 AGAAGTAAATGGATGGTGCAGGG - Intergenic
1041525203 8:58797721-58797743 ATTAATAAATGGATGGCAAGTGG - Intergenic
1041835869 8:62214516-62214538 ATTAAAAGATGGATGATGAGAGG + Intergenic
1041840172 8:62260627-62260649 CTTTATATCTGGATGGTGAACGG + Intronic
1042151237 8:65787314-65787336 ATTCATAAACTGATGGTTAAAGG + Intronic
1042964270 8:74334298-74334320 ATGAATAAATGGTGGATGAATGG - Intronic
1043428533 8:80171827-80171849 ATAAATAACTTGATGGTGGAAGG - Intronic
1043961890 8:86426374-86426396 ATTTATAATTGGTTGCTGAAAGG + Intronic
1044136126 8:88588278-88588300 ATTAATTAATGGATGAGGCAAGG - Intergenic
1044425433 8:92044671-92044693 CTCAATAAGTGGTTGGTGAAAGG - Intronic
1045160600 8:99539194-99539216 ATTTACAAATTAATGGTGAAAGG - Intronic
1045359868 8:101423089-101423111 ATTCATGAATGGGTGGTGCATGG + Intergenic
1045395581 8:101757713-101757735 ATTAATACAGGGATAGAGAAAGG - Intronic
1045517586 8:102873905-102873927 ATTAATAAATGGTTGCAGGAAGG + Intronic
1045709593 8:104967505-104967527 CTTAATAAATGGTTGTTGAAAGG - Intronic
1046052394 8:109039340-109039362 ATAAATGGATGGATGATGAATGG + Intergenic
1046072386 8:109272964-109272986 ATGAATAATTGGAAGGGGAAGGG - Intronic
1046102966 8:109635648-109635670 AACTATAAATGGAAGGTGAAGGG - Intronic
1046190682 8:110790692-110790714 ATTAACAAGAGAATGGTGAAGGG + Intergenic
1046298573 8:112256102-112256124 ATTAATAAATGTAAGTTGAATGG - Intronic
1046592730 8:116225450-116225472 AGAAATAAATGGAAGGTGGAAGG - Intergenic
1046937434 8:119898373-119898395 ATTTATAAATTGATTTTGAAAGG + Intronic
1046999419 8:120558789-120558811 ATTAATAAATGAATATTGCATGG + Intronic
1047027117 8:120836200-120836222 ATAAAGAAATGGATGTTGAGGGG + Intergenic
1047266078 8:123310341-123310363 ATAGGTAAATGGGTGGTGAAAGG + Intergenic
1047376967 8:124308587-124308609 ATAAATAAATAAATGGTGGAGGG + Intergenic
1048110631 8:131464507-131464529 ATTAATAACTGGATTGGAAAAGG + Intergenic
1048133241 8:131720503-131720525 TTGAATAAATGCGTGGTGAATGG + Intergenic
1048187856 8:132260774-132260796 ATAATTAAATGGATGGATAATGG - Intronic
1048289839 8:133172288-133172310 ATGAATGAATGGATGATGGATGG - Intergenic
1048297016 8:133221903-133221925 ATTAATGGATGGATGGAGGATGG + Intronic
1048523224 8:135176836-135176858 ATGAATAAATGGATTGAGAGAGG - Intergenic
1048883447 8:138888896-138888918 ATTGATGAATGAATGATGAACGG + Intronic
1049119509 8:140722035-140722057 ATTAATAAATGACAGGTAAATGG + Intronic
1049204864 8:141359003-141359025 ATTTATAAATGAAGGGTTAACGG + Intronic
1049233416 8:141495941-141495963 ATGACTGGATGGATGGTGAAAGG - Intergenic
1049364258 8:142229114-142229136 ATGGATAAATGGATGGTGGGTGG + Intronic
1049364290 8:142229244-142229266 ATGAATGGATGGATGGTGGATGG + Intronic
1049889476 9:55268-55290 AATAATGAATGCATGATGAATGG + Intergenic
1049889583 9:56103-56125 AAAAATAAATGAATGATGAATGG + Intergenic
1050230468 9:3519415-3519437 ATTAAAAAAGGGATGGTCAAAGG + Intronic
1050584172 9:7092902-7092924 ATTAAGAAATAGAGGGAGAATGG + Intergenic
1050635309 9:7606121-7606143 ATAAATAAATGGATGGAGTGGGG - Intergenic
1051005955 9:12344887-12344909 ATTAATAGATGAATGGTTAAAGG + Intergenic
1051467629 9:17398423-17398445 ATTAATAGGTGATTGGTGAAAGG + Intronic
1051591686 9:18782587-18782609 ATTAACAAATGAATGGAGCAAGG + Intronic
1052132195 9:24861925-24861947 ATTAATAAATGGGTGTTGGTTGG + Intergenic
1052814897 9:33094608-33094630 ATTACTAAAAGAATAGTGAAAGG + Intergenic
1053654547 9:40203242-40203264 ATTTCTAAATGGATTCTGAATGG - Intergenic
1053730962 9:41056541-41056563 AATAATGAATGCATGATGAATGG + Intergenic
1053731066 9:41057378-41057400 AAAAATAAATGAATGATGAATGG + Intergenic
1053904938 9:42832454-42832476 ATTTCTAAATGGATTCTGAATGG - Intergenic
1054366662 9:64349459-64349481 ATTTCTAAATGGATTCTGAATGG - Intergenic
1054530047 9:66173069-66173091 ATTTCTAAATGGATTCTGAACGG + Intergenic
1054674291 9:67839201-67839223 ATTTCTAAATGGATTCTGAATGG - Intergenic
1054697446 9:68374711-68374733 AAAAATAAATGAATGATGAACGG - Intronic
1055446720 9:76391472-76391494 TTTACTACATGGATGGTGGATGG - Intronic
1055879021 9:80976424-80976446 ATTAAGAAATGTTTGCTGAATGG + Intergenic
1055959838 9:81809683-81809705 ATTTATATATTAATGGTGAATGG - Intergenic
1057031722 9:91780895-91780917 ATTAATAAATGCTTGCTTAATGG - Intronic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1057273258 9:93662572-93662594 ATGAACAAATGCATGGTGCATGG + Intronic
1057323899 9:94042129-94042151 ATAAGTAAAAGGATGGTGAATGG - Intronic
1057441264 9:95085411-95085433 ATAAATAAAGGGACGGTGACCGG - Intronic
1058345085 9:103951404-103951426 ATTAACAATTTGATGGTGAGAGG - Intergenic
1058504033 9:105651364-105651386 TTTAATAAATTAATGGTGGATGG + Intergenic
1058942725 9:109828893-109828915 ATTAGAAAATGGATCTTGAAAGG + Intronic
1059214038 9:112543409-112543431 ATTAGTAAATGGATGCTGAGTGG + Intronic
1059409070 9:114120725-114120747 ATAGATAGATGGATGATGAATGG + Intergenic
1059739447 9:117135473-117135495 ATTAATGAATGGATGGAGACGGG - Intronic
1060165438 9:121410200-121410222 TTAAGTAAATGGATGGTGGATGG - Intergenic
1060289560 9:122288528-122288550 ATTAACAAACGAATGGTGAAAGG - Intronic
1060899169 9:127242513-127242535 ATTAATAAATGGCTTGTTCATGG - Intronic
1061051313 9:128197517-128197539 AAAAATAAATGGAGTGTGAAAGG + Intronic
1061244648 9:129395190-129395212 ATGAAAAAATGGATGGAGGATGG + Intergenic
1061399583 9:130361047-130361069 ATGACTGAATGGATGGTGAATGG - Intronic
1061417513 9:130455109-130455131 ATGAATAAATGGATGATGGATGG - Intronic
1061950523 9:133933489-133933511 ATGGATGGATGGATGGTGAATGG + Intronic
1061950652 9:133934063-133934085 ATGGATAGATGGATGGTGAGTGG + Intronic
1062092317 9:134684933-134684955 ATGGATGAATGGATGGTGGATGG - Intronic
1062092322 9:134684956-134684978 ATTAATGGATGGATGGTGGATGG - Intronic
1062092328 9:134684987-134685009 ATTAATGGATGGATGGTGGATGG - Intronic
1062092354 9:134685095-134685117 ATGAATGGATGGATGGTGGATGG - Intronic
1062092368 9:134685157-134685179 ATGAATGGATGGATGGTGGATGG - Intronic
1062092387 9:134685247-134685269 CTTAATGGATGGATGGTGGATGG - Intronic
1062092399 9:134685301-134685323 ATGAATGGATGGATGGTGGATGG - Intronic
1062092419 9:134685391-134685413 ATTAATGGATGGATGGTGGATGG - Intronic
1062201236 9:135303911-135303933 ATGGATAAATGGAGGGTGGATGG + Intergenic
1062247951 9:135579234-135579256 ATGAATAAATCGTGGGTGAATGG - Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1185838885 X:3370100-3370122 TTTAATGAAAGGATGGTGGAAGG - Intergenic
1185842284 X:3403054-3403076 ATAAATAAATGGATGAAGGAAGG - Intergenic
1186150470 X:6669474-6669496 ATGAATGAATGGATGGAGAGTGG + Intergenic
1186986309 X:15017925-15017947 ATTAATGAATAAATGATGAATGG - Intergenic
1188280041 X:28255928-28255950 CTTAATAAATGAATGTTTAATGG - Intergenic
1188969947 X:36602877-36602899 TTTAATAAATGTTTGTTGAAAGG - Intergenic
1189022491 X:37355431-37355453 ATTGGTAAATTGCTGGTGAAAGG + Intronic
1189873414 X:45408055-45408077 ATTAATAAATTAATAATGAAGGG + Intergenic
1189931800 X:46019773-46019795 ATTAATACATAGAGGGTGAATGG - Intergenic
1190561185 X:51686910-51686932 ATGAGTAAATGGATGGTGGAGGG - Intergenic
1190563106 X:51706407-51706429 ATGAGTAAATGGATGGTGGAGGG + Intergenic
1190942761 X:55058486-55058508 TTTAAAAAATGGCAGGTGAAAGG - Intergenic
1191225346 X:58036509-58036531 ATTCATACATGTATGGTCAATGG + Intergenic
1193249725 X:79276207-79276229 ATAATGAAATGGGTGGTGAAAGG + Intergenic
1193853997 X:86576043-86576065 ATGAATGAATGGATGAAGAAAGG - Intronic
1193893004 X:87074656-87074678 ATTAATAAATGGATTGGATATGG + Intergenic
1194815741 X:98439572-98439594 ATTAATAAGTAAATGGTGTATGG - Intergenic
1194929758 X:99872386-99872408 TTTAATAAATGGTTGGTGCTGGG + Intergenic
1194978196 X:100413678-100413700 ATTGATAAGGGTATGGTGAAAGG + Intergenic
1195536806 X:106017536-106017558 ATTTATAAATCTATGGTGATGGG - Intergenic
1196136334 X:112213332-112213354 GTTAATAAATGGGTGGTGCTTGG + Intergenic
1199047073 X:143187247-143187269 ATTAATAGATGTATAGAGAAAGG + Intergenic
1199124838 X:144105014-144105036 ATTTTTAAATGGATGGGAAATGG + Intergenic
1199667412 X:150109858-150109880 AAAAACAAATGGATGGAGAAGGG - Intergenic
1200974828 Y:9197640-9197662 ACTAATAAATGGAAGGGGAGGGG + Intergenic
1201236888 Y:11920696-11920718 TTTAATGAAAGGATGGTGGAAGG + Intergenic
1201733569 Y:17232200-17232222 ATTAATCCATGGGTGTTGAAAGG + Intergenic