ID: 1153866438

View in Genome Browser
Species Human (GRCh38)
Location 18:9273788-9273810
Sequence CTCAATGCTCTGGGAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9501
Summary {0: 1, 1: 2, 2: 99, 3: 1043, 4: 8356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153866438_1153866443 4 Left 1153866438 18:9273788-9273810 CCTTAGCCTCCCAGAGCATTGAG 0: 1
1: 2
2: 99
3: 1043
4: 8356
Right 1153866443 18:9273815-9273837 CAGGCAAAAGCCACTGTGCCTGG 0: 5
1: 651
2: 10064
3: 37455
4: 93802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153866438 Original CRISPR CTCAATGCTCTGGGAGGCTA AGG (reversed) Intronic
Too many off-targets to display for this crispr