ID: 1153867597

View in Genome Browser
Species Human (GRCh38)
Location 18:9287185-9287207
Sequence ATGCATGTAAATCAGCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153867597_1153867602 19 Left 1153867597 18:9287185-9287207 CCGTCCTGCTGATTTACATGCAT No data
Right 1153867602 18:9287227-9287249 GCACACACTTAGGACTCCATGGG No data
1153867597_1153867604 29 Left 1153867597 18:9287185-9287207 CCGTCCTGCTGATTTACATGCAT No data
Right 1153867604 18:9287237-9287259 AGGACTCCATGGGGTGTGTCAGG No data
1153867597_1153867601 18 Left 1153867597 18:9287185-9287207 CCGTCCTGCTGATTTACATGCAT No data
Right 1153867601 18:9287226-9287248 AGCACACACTTAGGACTCCATGG No data
1153867597_1153867603 20 Left 1153867597 18:9287185-9287207 CCGTCCTGCTGATTTACATGCAT No data
Right 1153867603 18:9287228-9287250 CACACACTTAGGACTCCATGGGG No data
1153867597_1153867599 9 Left 1153867597 18:9287185-9287207 CCGTCCTGCTGATTTACATGCAT No data
Right 1153867599 18:9287217-9287239 AAATCAACCAGCACACACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153867597 Original CRISPR ATGCATGTAAATCAGCAGGA CGG (reversed) Intergenic
No off target data available for this crispr