ID: 1153868755

View in Genome Browser
Species Human (GRCh38)
Location 18:9297241-9297263
Sequence CGCAGCCTGAGCCTCCCCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153868742_1153868755 6 Left 1153868742 18:9297212-9297234 CCCCCCAACCCCTGCCCTGTGGG No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868740_1153868755 12 Left 1153868740 18:9297206-9297228 CCTGAGCCCCCCAACCCCTGCCC No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868739_1153868755 20 Left 1153868739 18:9297198-9297220 CCGACATGCCTGAGCCCCCCAAC No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868747_1153868755 2 Left 1153868747 18:9297216-9297238 CCAACCCCTGCCCTGTGGGCTCC No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868752_1153868755 -9 Left 1153868752 18:9297227-9297249 CCTGTGGGCTCCCTCGCAGCCTG No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868745_1153868755 4 Left 1153868745 18:9297214-9297236 CCCCAACCCCTGCCCTGTGGGCT No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868748_1153868755 -2 Left 1153868748 18:9297220-9297242 CCCCTGCCCTGTGGGCTCCCTCG No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868749_1153868755 -3 Left 1153868749 18:9297221-9297243 CCCTGCCCTGTGGGCTCCCTCGC No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868746_1153868755 3 Left 1153868746 18:9297215-9297237 CCCAACCCCTGCCCTGTGGGCTC No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868750_1153868755 -4 Left 1153868750 18:9297222-9297244 CCTGCCCTGTGGGCTCCCTCGCA No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868744_1153868755 5 Left 1153868744 18:9297213-9297235 CCCCCAACCCCTGCCCTGTGGGC No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868738_1153868755 21 Left 1153868738 18:9297197-9297219 CCCGACATGCCTGAGCCCCCCAA No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data
1153868751_1153868755 -8 Left 1153868751 18:9297226-9297248 CCCTGTGGGCTCCCTCGCAGCCT No data
Right 1153868755 18:9297241-9297263 CGCAGCCTGAGCCTCCCCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153868755 Original CRISPR CGCAGCCTGAGCCTCCCCGA CGG Intergenic
No off target data available for this crispr