ID: 1153871147

View in Genome Browser
Species Human (GRCh38)
Location 18:9321574-9321596
Sequence TCCATGAATGTGTCAACACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153871146_1153871147 2 Left 1153871146 18:9321549-9321571 CCTGTGCTGGACACGTGGCTGTT No data
Right 1153871147 18:9321574-9321596 TCCATGAATGTGTCAACACTCGG No data
1153871143_1153871147 8 Left 1153871143 18:9321543-9321565 CCTAGCCCTGTGCTGGACACGTG No data
Right 1153871147 18:9321574-9321596 TCCATGAATGTGTCAACACTCGG No data
1153871145_1153871147 3 Left 1153871145 18:9321548-9321570 CCCTGTGCTGGACACGTGGCTGT No data
Right 1153871147 18:9321574-9321596 TCCATGAATGTGTCAACACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153871147 Original CRISPR TCCATGAATGTGTCAACACT CGG Intergenic
No off target data available for this crispr