ID: 1153872089

View in Genome Browser
Species Human (GRCh38)
Location 18:9330906-9330928
Sequence AGGAAGGCCTAGAATTGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153872077_1153872089 21 Left 1153872077 18:9330862-9330884 CCTCTTTTCATTCCTTGTTCTCT No data
Right 1153872089 18:9330906-9330928 AGGAAGGCCTAGAATTGAAAGGG No data
1153872076_1153872089 28 Left 1153872076 18:9330855-9330877 CCTTCAACCTCTTTTCATTCCTT No data
Right 1153872089 18:9330906-9330928 AGGAAGGCCTAGAATTGAAAGGG No data
1153872082_1153872089 9 Left 1153872082 18:9330874-9330896 CCTTGTTCTCTGGGGTGGATTAG No data
Right 1153872089 18:9330906-9330928 AGGAAGGCCTAGAATTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153872089 Original CRISPR AGGAAGGCCTAGAATTGAAA GGG Intergenic
No off target data available for this crispr