ID: 1153878008

View in Genome Browser
Species Human (GRCh38)
Location 18:9393399-9393421
Sequence TGATCCACTTGGTGTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 1, 2: 10, 3: 41, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153877999_1153878008 22 Left 1153877999 18:9393354-9393376 CCAAGTCTGCCTTTGGGGCTGAG 0: 1
1: 0
2: 1
3: 21
4: 229
Right 1153878008 18:9393399-9393421 TGATCCACTTGGTGTCAGCTGGG 0: 1
1: 1
2: 10
3: 41
4: 169
1153878001_1153878008 13 Left 1153878001 18:9393363-9393385 CCTTTGGGGCTGAGTTTTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 181
Right 1153878008 18:9393399-9393421 TGATCCACTTGGTGTCAGCTGGG 0: 1
1: 1
2: 10
3: 41
4: 169
1153877998_1153878008 23 Left 1153877998 18:9393353-9393375 CCCAAGTCTGCCTTTGGGGCTGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1153878008 18:9393399-9393421 TGATCCACTTGGTGTCAGCTGGG 0: 1
1: 1
2: 10
3: 41
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153878008 Original CRISPR TGATCCACTTGGTGTCAGCT GGG Intronic
901052585 1:6432690-6432712 TGAACCCCTTGGGCTCAGCTGGG + Intronic
902481657 1:16715346-16715368 TGAACCCCTTGGGCTCAGCTGGG - Intergenic
904276096 1:29385253-29385275 TGGGCCACTTGGTGTCAGCCAGG + Intergenic
908775920 1:67639797-67639819 TATTCCACATTGTGTCAGCTGGG - Intergenic
908797149 1:67841799-67841821 TAGTCTACTTGGTGTCAGATGGG - Intergenic
909488364 1:76198939-76198961 TGATCTACCTGGTGTCACCCAGG - Intronic
910274903 1:85438600-85438622 TGCTTTGCTTGGTGTCAGCTGGG - Intronic
910278863 1:85476385-85476407 TGATCCACATGGAGTCCACTGGG + Intronic
916537387 1:165716453-165716475 TGGTCAACTTTGTGTCAACTTGG - Intergenic
917942927 1:179941297-179941319 TGTTCCAGTTGGTGTTAGCTGGG + Intergenic
919166836 1:193906116-193906138 TCATTCTCTTGGTGTCAGCAAGG - Intergenic
922344678 1:224686583-224686605 TGATCCATTTGATGTCACTTAGG - Intronic
922362020 1:224831721-224831743 TGTTCCACTTGGCTTCAGCTGGG - Intergenic
924467248 1:244309769-244309791 TGAACAACTTAGTTTCAGCTTGG + Intergenic
1063836565 10:10021351-10021373 AGCTCCACTTGGCATCAGCTGGG - Intergenic
1065375760 10:25039804-25039826 TGTTCCACATGGTTTCAGCCAGG + Intronic
1065710594 10:28513389-28513411 TTATTCACTTGTAGTCAGCTTGG - Intergenic
1068008926 10:51423188-51423210 TGATCAACCTGGTGTCATTTTGG - Intronic
1068638168 10:59370649-59370671 TGATCCATGTGGTGACATCTGGG + Intergenic
1071556280 10:86604893-86604915 TGCTCCATTTAGTGTTAGCTGGG + Intergenic
1072707671 10:97693401-97693423 TGATTAACTTGGTGTCTGCTAGG - Intergenic
1073230072 10:101961725-101961747 TTGTCCACTTGATGTCATCTGGG + Intronic
1074689667 10:115992725-115992747 TGAGCCACTTGGTGTGGCCTGGG - Intergenic
1075107532 10:119551294-119551316 TGATCAGCTTGGTGTCAGTTTGG - Intergenic
1075414036 10:122249423-122249445 AGCTCCAGTTGGTGGCAGCTGGG + Intronic
1077294054 11:1815836-1815858 AGGACCACTTGATGTCAGCTGGG + Intergenic
1078009862 11:7564656-7564678 TGTTCCACTTGGTGTCAGTCGGG + Intronic
1078368743 11:10727752-10727774 GGACTCACTTGGTGTCGGCTTGG + Intergenic
1078399959 11:11017518-11017540 GGATGCACGTTGTGTCAGCTAGG + Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1079143266 11:17828428-17828450 GGATCCAGCTGGAGTCAGCTGGG + Intronic
1079405007 11:20137102-20137124 TGAGCTACTTGGTGACAGGTTGG + Intergenic
1084105802 11:66979494-66979516 TGCTCCATGTGGTGTCAGCTGGG - Intergenic
1088091178 11:106041689-106041711 TGTTCCATTTGGTGTCAGCTAGG - Intergenic
1088880905 11:113972609-113972631 TGAACCATTTGGAGACAGCTGGG - Intergenic
1089455760 11:118624980-118625002 TCATCCACTTGGCTTCAGCCGGG - Exonic
1092639865 12:10493974-10493996 TGATCCTACTGGTGTCAGGTTGG + Intergenic
1094396577 12:30013318-30013340 TGCCCCATTTGGTGTCAGCTAGG - Intergenic
1095413688 12:41952281-41952303 TGATTCAGTTGGTATGAGCTGGG - Intergenic
1095460133 12:42434576-42434598 TAACCCAGTTGGTGTCTGCTGGG + Intronic
1095659215 12:44709497-44709519 TGCTCCACATGGTGTTAACTGGG - Intronic
1095772191 12:45972253-45972275 TGATCCAGTTGGGTTCAGGTTGG - Intronic
1098098318 12:66984939-66984961 TTATCCACATATTGTCAGCTGGG + Intergenic
1098231957 12:68380510-68380532 TGCTCCACTTGGCACCAGCTAGG + Intergenic
1098970982 12:76856778-76856800 TGCTCCACCTGGGATCAGCTGGG + Intergenic
1100378460 12:94039606-94039628 TGTTCCACATGGTGTCAGCAGGG - Intergenic
1102173165 12:110857510-110857532 TGATCCAATTGGTCTCAGGTTGG + Intronic
1102598431 12:114011224-114011246 TGATTCACTTGGGGTCCACTAGG + Intergenic
1102687332 12:114735166-114735188 TCATTCAATTGGTCTCAGCTGGG - Intergenic
1105815591 13:24033495-24033517 CTATCCTCTTGGTTTCAGCTCGG + Intronic
1105982665 13:25534863-25534885 TGATTCACTGGGTCTCAGGTGGG + Intronic
1108180436 13:47835168-47835190 TGATTCACTTGGTCTGGGCTGGG - Intergenic
1108407653 13:50121797-50121819 TAATCCACTGGATGACAGCTGGG - Intronic
1109612067 13:64779233-64779255 GGATTCACTTGAAGTCAGCTTGG + Intergenic
1111368933 13:87290286-87290308 TGCTTCACATGGTGTCATCTGGG - Intergenic
1111435081 13:88196274-88196296 TTCTCCACTTGGTGGCAGCAAGG - Intergenic
1113093922 13:106643492-106643514 TAAACAACTTGGTTTCAGCTTGG - Intergenic
1117680005 14:58194178-58194200 GATTCCACATGGTGTCAGCTAGG - Intronic
1117806215 14:59493400-59493422 TGCTCCACATGGTGTCAATTTGG - Intronic
1119128316 14:72149009-72149031 CGCACCACTTGGTGTCAGCTGGG + Intronic
1119747692 14:77056070-77056092 TGCTCCATGTGGTGTCAGCTGGG + Intergenic
1121556076 14:94838625-94838647 TGATCCATATGGTGTTACCTGGG - Intergenic
1121574758 14:94974992-94975014 TGCTTCATGTGGTGTCAGCTGGG + Intergenic
1122248559 14:100422141-100422163 TGCTCCACTTGGTATCATGTGGG + Intronic
1122821641 14:104349408-104349430 TCATTCAGTTGGTGTCAGCGGGG + Intergenic
1125551517 15:40548557-40548579 TGTACCACTTGGTGTCACCTGGG + Intronic
1125994439 15:44144371-44144393 TTATCCACTGGGTGACAGCTAGG + Intronic
1126913281 15:53437368-53437390 TGCTCCACTTGGTATCAGATAGG + Intergenic
1128845536 15:70891769-70891791 TCCTCCACTTAGTGTCACCTTGG - Intronic
1130821592 15:87501949-87501971 TGATCCATTTGTTGTCTACTGGG + Intergenic
1131338139 15:91570324-91570346 TGATCAACCTGGTATCAGCCTGG - Intergenic
1131693125 15:94847330-94847352 AGATCCACTTGATGACATCTTGG + Intergenic
1132624206 16:882555-882577 TGCTGCACGTGGTGTCAGGTGGG - Intronic
1135986623 16:27188934-27188956 TGTTCCACTTGGTATCAACTGGG - Intergenic
1138136412 16:54527174-54527196 TATTCCACATGGTGTCATCTAGG + Intergenic
1138218381 16:55226148-55226170 TGAGTTACATGGTGTCAGCTGGG + Intergenic
1138471649 16:57242972-57242994 TATTCCAGTTGGTGTCGGCTGGG - Intergenic
1139623546 16:68166268-68166290 CCATTCACATGGTGTCAGCTGGG + Intronic
1140202942 16:72909112-72909134 TCATGCAATTGTTGTCAGCTCGG - Intronic
1141194849 16:81852784-81852806 TGTTCCACATGTTGTCAGCTGGG + Intronic
1143093681 17:4465104-4465126 TTTTCCACTTGGTGTTAGCTAGG + Intronic
1148382902 17:47212816-47212838 TGAACAACTTAGTTTCAGCTTGG + Intronic
1148980750 17:51572324-51572346 TGTTCCACATGGTAACAGCTGGG - Intergenic
1150363052 17:64554622-64554644 TGTTCCACAAGATGTCAGCTAGG - Intronic
1151484667 17:74391066-74391088 TAAACAACTTAGTGTCAGCTGGG - Intergenic
1152241361 17:79163073-79163095 TGAACCACTCTGTTTCAGCTTGG - Intronic
1153062033 18:1004723-1004745 TGATCCACTTGGGTGCTGCTTGG - Intergenic
1153445763 18:5171002-5171024 TGCTTCACTTGGCATCAGCTGGG - Intronic
1153878008 18:9393399-9393421 TGATCCACTTGGTGTCAGCTGGG + Intronic
1155267287 18:24106280-24106302 TGGTGCACTTGGAGGCAGCTAGG - Intronic
1156521803 18:37728196-37728218 TGATTCAATTGGTGTGAGGTGGG + Intergenic
1158628697 18:59093498-59093520 TGCTCCAAGTGGTGTCTGCTGGG + Intergenic
1159047298 18:63381529-63381551 TGCTCCACATGGTGTTGGCTGGG - Intergenic
1164031444 19:21409699-21409721 TGTGCCACTTCATGTCAGCTTGG + Intronic
1165339918 19:35204115-35204137 TGCCCCACTTGGTGACAGCATGG + Intergenic
1202715696 1_KI270714v1_random:41258-41280 TGAACCCCTTGGGCTCAGCTGGG - Intergenic
925588292 2:5485028-5485050 TGTTCTACTTGATGTCAGCTGGG - Intergenic
925669977 2:6301017-6301039 TGTTCCATTTGGTGTCAGCTGGG + Intergenic
925961563 2:9021963-9021985 TGATTCACATGGTGGCAGCTGGG + Intergenic
927146555 2:20169968-20169990 TGCTCCACTTGGCTTCAGCTGGG + Intergenic
927728054 2:25443560-25443582 AGATGCACCTGGTATCAGCTAGG + Intronic
927807496 2:26161041-26161063 AGATGGACTTGGTGTCATCTGGG - Intergenic
929378854 2:41324897-41324919 TGCTCCACTCAGTGTTAGCTGGG - Intergenic
929431972 2:41894806-41894828 TGCTCCACTTGGTATCAGCTGGG + Intergenic
929801660 2:45109814-45109836 TCACCCACTGGGTGTGAGCTGGG + Intergenic
930622122 2:53654399-53654421 TATTTCACTTGGTGTCAGCTGGG + Intronic
933412400 2:81942367-81942389 TGCTTTACTTGTTGTCAGCTGGG - Intergenic
933657496 2:84901708-84901730 TGCTCCACTTGGCATTAGCTGGG + Intronic
934063435 2:88318376-88318398 TGATCTACTTGGCATCAGCTGGG + Intergenic
934961832 2:98682610-98682632 TGATGAAGGTGGTGTCAGCTAGG - Intronic
935039290 2:99410508-99410530 TAATGCACTTGGTTTCAGCGAGG - Intronic
937895048 2:126971878-126971900 TGATCCACGTGGTGTCGACTGGG - Intergenic
939927955 2:148197313-148197335 TGCTCCACTTGGTACCAGCTGGG - Intronic
940167159 2:150786924-150786946 GGATCCACATGGTGTCACCAGGG - Intergenic
940390749 2:153130069-153130091 TGATGCACTTGGTATTAGGTAGG - Intergenic
941992145 2:171567878-171567900 TGCTCAACTCAGTGTCAGCTGGG - Intergenic
942082760 2:172416858-172416880 TGCTCCATTTAGTGTCAGCTGGG + Intergenic
945255568 2:207800354-207800376 TGATCCACTAGGTCTGAGGTGGG - Intergenic
947438079 2:230090543-230090565 TCATCCTCTTGGTGACAGGTGGG + Intergenic
947836532 2:233179961-233179983 TGCTCTAGTTGGTGTCATCTGGG + Intronic
948165239 2:235856334-235856356 TGATTCGCTTGGTGTCAGTAAGG + Intronic
1169334350 20:4743116-4743138 TGATCCACTTGGTAACAGAGCGG + Intergenic
1170015551 20:11777601-11777623 TGATTCAGTAGGTCTCAGCTGGG - Intergenic
1170593913 20:17791520-17791542 TGTTCCACGTGGAGTCAGGTGGG - Intergenic
1170863656 20:20133260-20133282 TCATGCATTTGGTGTCAACTAGG + Intronic
1171383531 20:24751744-24751766 TGATGCAGTAGGTGTGAGCTGGG + Intergenic
1172919556 20:38469830-38469852 TGCTCAGCTTGGTGTCAGGTTGG + Intergenic
1174958897 20:55133159-55133181 TGCTCCACTTAGTATCAACTAGG + Intergenic
1175334147 20:58184233-58184255 TGCTCCACACGGTGTCAGCTGGG + Intergenic
1175662722 20:60829958-60829980 TGTTTTACTTGGTGTCAGCATGG + Intergenic
1176861454 21:14013495-14013517 TCATCCATATGGTGTCTGCTGGG - Intergenic
1178375267 21:32061450-32061472 TGCTCCACGTGGTGTCAACCTGG - Intergenic
1180392601 22:12298287-12298309 TGATGTGCTTGGTGTGAGCTGGG + Intergenic
1180407147 22:12566481-12566503 TGATGTGCTTGGTGTGAGCTGGG - Intergenic
1182145212 22:27993232-27993254 TGTTCCACCTGCTGTCAGCCAGG + Intronic
950252805 3:11480806-11480828 CTATCCACTGGGTGACAGCTCGG + Intronic
950847492 3:16029109-16029131 TGCTCCAGGTGATGTCAGCTGGG + Intergenic
951695087 3:25438030-25438052 TGCTCCGCATGCTGTCAGCTGGG + Intronic
955855011 3:63263560-63263582 TGTTCCACATGGTGTCAGTTGGG + Intronic
959844261 3:111014774-111014796 TGATTCAGTTGGTGTGAGGTGGG - Intergenic
962276565 3:134019030-134019052 TGCTCCCCTTGGTCACAGCTGGG + Intronic
963304403 3:143635102-143635124 TGCTCCACGTGGTATCAGCTGGG + Intronic
964036061 3:152198158-152198180 TAAACAACTTGGTTTCAGCTTGG + Intergenic
965423335 3:168490057-168490079 TGATCCAGTAGGTGTGAGATGGG - Intergenic
966317359 3:178663036-178663058 TGCTCCACGTGGTGTTGGCTAGG + Intronic
967144037 3:186590985-186591007 TGCTCTACTTGGTGTCAGCTGGG + Intronic
967237198 3:187396961-187396983 TGATCCACAGGGTGTCAGCTGGG - Intergenic
968859739 4:3157651-3157673 TGAGCCACTTGTTATCAGCTAGG + Intronic
970407996 4:15781951-15781973 TGTTTCACTTGGTGTCAGCTGGG + Intronic
972696967 4:41456753-41456775 TGTTCCACTCACTGTCAGCTGGG + Intronic
972701464 4:41497983-41498005 TGAACCACTGAGTCTCAGCTGGG + Intronic
974484069 4:62484362-62484384 TGCTGCATTTGCTGTCAGCTAGG + Intergenic
976436539 4:85024918-85024940 TGTTCCATGTGGTGTCAGCTAGG - Intergenic
977649452 4:99453505-99453527 TGATCCAATAGGTGTCACTTAGG + Intergenic
978827132 4:113038912-113038934 TGATACATGTGGTGTCAGCTGGG - Intronic
980177830 4:129368159-129368181 TGATCCACATGGTCAAAGCTGGG - Intergenic
982074683 4:151726870-151726892 TGAGGCACTTGATGTCAGCATGG + Intronic
982964963 4:161894686-161894708 TGATTCACTTGAGGTCAGCCTGG - Intronic
983554126 4:169044923-169044945 CGCTCCACTTGGCTTCAGCTGGG + Intergenic
984767945 4:183413852-183413874 TGGTCTACTTGGGGTCAGCAAGG + Intergenic
985378816 4:189371047-189371069 TCAGCCACTGAGTGTCAGCTTGG - Intergenic
986827450 5:11537012-11537034 TGATTCACTTGGTCTCGGATGGG - Intronic
987674751 5:21061369-21061391 TGATCCAGTAGGTGTCATTTAGG + Intergenic
990037913 5:51345362-51345384 GGATACACTTGGCTTCAGCTGGG - Intergenic
990137877 5:52669028-52669050 TGATCAGCTTGGGGCCAGCTGGG - Intergenic
990221622 5:53597067-53597089 TGCTCCATGTGGTGTCTGCTGGG + Intronic
991036591 5:62133601-62133623 TACTCCACATGGTGTCAGCTGGG - Intergenic
991097130 5:62751313-62751335 TGCTCCACTTGGAGTTGGCTGGG + Intergenic
991606182 5:68403445-68403467 TGCTCCACTCGGTATCAACTGGG - Intergenic
992360330 5:76031456-76031478 TGATCCACTCGGTGCCTGCCAGG + Intergenic
993847859 5:92967648-92967670 TGATTCCCATGGTGTCACCTAGG - Intergenic
997908623 5:137845687-137845709 TGATCCAAGTGTTGACAGCTGGG - Intergenic
1000012756 5:157248040-157248062 TGATCCACTGGGTTTGGGCTAGG + Intronic
1000246689 5:159454064-159454086 TGATCCACTGGCTCCCAGCTAGG - Intergenic
1001306281 5:170576078-170576100 TGCTCCATGTGGAGTCAGCTGGG + Intronic
1005638244 6:27771318-27771340 TTCTCCACAGGGTGTCAGCTGGG + Intergenic
1006499047 6:34445720-34445742 GGATCCACTGGGGGTCAGTTAGG + Intergenic
1006784310 6:36655064-36655086 TGCTCCACTTGGCATCAGCAGGG + Intergenic
1007215844 6:40236436-40236458 TGATCCAGTAGGTGTCACTTAGG - Intergenic
1008151291 6:47955059-47955081 TGCTCCACTCAGAGTCAGCTGGG - Intronic
1010760664 6:79718733-79718755 AGTTCCACATGATGTCAGCTGGG - Intergenic
1012924290 6:105251949-105251971 TGATAAAGTTGGTGTCAACTGGG + Intergenic
1017759607 6:157557657-157557679 TGGTCCACCTCTTGTCAGCTGGG + Intronic
1019862043 7:3668245-3668267 TGCTCCACCTGGTGTCAGCTAGG + Intronic
1022202412 7:28129428-28129450 TGATTCATTTGGTGTGAACTGGG + Intronic
1022627126 7:32048615-32048637 TGATCCACCTGGTGTCAACTGGG - Intronic
1022821974 7:33970912-33970934 AGATCCTTTTGCTGTCAGCTAGG - Intronic
1023109759 7:36797365-36797387 TGCACCACTTGGTAGCAGCTGGG - Intergenic
1023840107 7:44092223-44092245 TGCTCCACACGGTGTCAGCTGGG - Intergenic
1024082993 7:45871436-45871458 TAATCCACTTGGAGTTATCTTGG - Intergenic
1024684063 7:51725954-51725976 TGCTCCACTTGGTGTCAGCTGGG + Intergenic
1026009134 7:66623257-66623279 TGATCCGCTTGGTGAAGGCTGGG + Intergenic
1026526049 7:71154341-71154363 TGCCCAACTTGGTATCAGCTGGG - Intronic
1030147734 7:106373307-106373329 TGGTCCACATGGCATCAGCTAGG - Intergenic
1031597885 7:123668958-123668980 TGAGCAACTTAGTGTAAGCTAGG + Intergenic
1032722328 7:134560391-134560413 AGAACCACGTGGTATCAGCTGGG - Intronic
1032860945 7:135878788-135878810 TGATCCCCATGGAGTCAGATTGG - Intergenic
1035585584 8:770555-770577 TAATTCACTTGGTGTCTCCTTGG + Intergenic
1037553862 8:20003614-20003636 TGTTCCACATGTTGTCACCTGGG + Intergenic
1038730558 8:30122989-30123011 TGCTCCACATGGTGTCAGCTGGG + Intronic
1041137468 8:54775610-54775632 TGCTCCACATAGTGTCAACTGGG - Intergenic
1042468547 8:69157200-69157222 TGGGGCACTTGGTGTCTGCTTGG - Intergenic
1043114527 8:76233591-76233613 TGCACCATTTGGTATCAGCTGGG - Intergenic
1045362953 8:101449777-101449799 TGCTCCACTTGGTGTCTGCTGGG - Intergenic
1045490306 8:102663144-102663166 TGCTCCATGTGGTGTCAGCTGGG - Intergenic
1046584520 8:116134813-116134835 TGCTCTACATGGTTTCAGCTGGG + Intergenic
1047691851 8:127363753-127363775 TTATCCACTTGCTGTCGACTGGG - Intergenic
1048289241 8:133167644-133167666 TGATCCACGTGGCATCAGCTGGG + Intergenic
1050239183 9:3616363-3616385 TGATCAAATTGGTTTCATCTTGG - Intergenic
1051184067 9:14440146-14440168 TGAGGCACCTGGTGTGAGCTGGG + Intergenic
1059772704 9:117442886-117442908 AGGTGCACTTGCTGTCAGCTTGG - Intergenic
1187650283 X:21394918-21394940 TGAACCAATTCGTTTCAGCTTGG + Intronic
1187685519 X:21812019-21812041 TGCTCCACATGATGTCAGTTGGG + Intergenic
1187932733 X:24308476-24308498 TGATGGACTTGGTGTCACTTAGG + Intergenic
1188030414 X:25257371-25257393 TAATCCACTGTTTGTCAGCTGGG - Intergenic
1189055435 X:37694762-37694784 TGATCCACTGTGGATCAGCTAGG + Intronic
1189270852 X:39750890-39750912 TGCTCTACTTGGTGGCAGCTGGG - Intergenic
1189281702 X:39823689-39823711 TGCTTCACTCAGTGTCAGCTGGG - Intergenic
1189295193 X:39912955-39912977 TCCTCCACTCGGTGTCAGCTGGG + Intergenic
1189340518 X:40201355-40201377 TGCTCCACGTAGTGTCAGCTGGG + Intergenic
1189365974 X:40388959-40388981 TGCTCCACTTGGCGTCAACTGGG + Intergenic
1195757590 X:108214452-108214474 TGATCCCTTTGGTTTCAGCTTGG - Intronic