ID: 1153878244

View in Genome Browser
Species Human (GRCh38)
Location 18:9396039-9396061
Sequence TAGGAACCAGAGCTCCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153878244_1153878247 29 Left 1153878244 18:9396039-9396061 CCTCCAAGGAGCTCTGGTTCCTA No data
Right 1153878247 18:9396091-9396113 TTCAGTATGCTTGAAGCTACTGG 0: 1
1: 0
2: 0
3: 6
4: 130
1153878244_1153878248 30 Left 1153878244 18:9396039-9396061 CCTCCAAGGAGCTCTGGTTCCTA No data
Right 1153878248 18:9396092-9396114 TCAGTATGCTTGAAGCTACTGGG 0: 1
1: 0
2: 1
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153878244 Original CRISPR TAGGAACCAGAGCTCCTTGG AGG (reversed) Intronic