ID: 1153878247

View in Genome Browser
Species Human (GRCh38)
Location 18:9396091-9396113
Sequence TTCAGTATGCTTGAAGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153878245_1153878247 26 Left 1153878245 18:9396042-9396064 CCAAGGAGCTCTGGTTCCTATTA No data
Right 1153878247 18:9396091-9396113 TTCAGTATGCTTGAAGCTACTGG 0: 1
1: 0
2: 0
3: 6
4: 130
1153878244_1153878247 29 Left 1153878244 18:9396039-9396061 CCTCCAAGGAGCTCTGGTTCCTA No data
Right 1153878247 18:9396091-9396113 TTCAGTATGCTTGAAGCTACTGG 0: 1
1: 0
2: 0
3: 6
4: 130
1153878246_1153878247 10 Left 1153878246 18:9396058-9396080 CCTATTATGTATTTAAAAAACAA 0: 1
1: 0
2: 14
3: 130
4: 1318
Right 1153878247 18:9396091-9396113 TTCAGTATGCTTGAAGCTACTGG 0: 1
1: 0
2: 0
3: 6
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153878247 Original CRISPR TTCAGTATGCTTGAAGCTAC TGG Intronic