ID: 1153878248

View in Genome Browser
Species Human (GRCh38)
Location 18:9396092-9396114
Sequence TCAGTATGCTTGAAGCTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153878245_1153878248 27 Left 1153878245 18:9396042-9396064 CCAAGGAGCTCTGGTTCCTATTA No data
Right 1153878248 18:9396092-9396114 TCAGTATGCTTGAAGCTACTGGG 0: 1
1: 0
2: 1
3: 7
4: 112
1153878246_1153878248 11 Left 1153878246 18:9396058-9396080 CCTATTATGTATTTAAAAAACAA 0: 1
1: 0
2: 14
3: 130
4: 1318
Right 1153878248 18:9396092-9396114 TCAGTATGCTTGAAGCTACTGGG 0: 1
1: 0
2: 1
3: 7
4: 112
1153878244_1153878248 30 Left 1153878244 18:9396039-9396061 CCTCCAAGGAGCTCTGGTTCCTA No data
Right 1153878248 18:9396092-9396114 TCAGTATGCTTGAAGCTACTGGG 0: 1
1: 0
2: 1
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153878248 Original CRISPR TCAGTATGCTTGAAGCTACT GGG Intronic