ID: 1153881650

View in Genome Browser
Species Human (GRCh38)
Location 18:9426461-9426483
Sequence TTGTACTTTTAGAAGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153881650_1153881658 26 Left 1153881650 18:9426461-9426483 CCCTGACTCTTCTAAAAGTACAA No data
Right 1153881658 18:9426510-9426532 GCCTGTAGTCCCAGCTACTCAGG 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
1153881650_1153881654 -5 Left 1153881650 18:9426461-9426483 CCCTGACTCTTCTAAAAGTACAA No data
Right 1153881654 18:9426479-9426501 TACAAAAAATTAGCTGGGCATGG 0: 6108
1: 20643
2: 47272
3: 60094
4: 100913
1153881650_1153881657 2 Left 1153881650 18:9426461-9426483 CCCTGACTCTTCTAAAAGTACAA No data
Right 1153881657 18:9426486-9426508 AATTAGCTGGGCATGGTGGTGGG 0: 3915
1: 20047
2: 48029
3: 73083
4: 72750
1153881650_1153881656 1 Left 1153881650 18:9426461-9426483 CCCTGACTCTTCTAAAAGTACAA No data
Right 1153881656 18:9426485-9426507 AAATTAGCTGGGCATGGTGGTGG 0: 8563
1: 27056
2: 52417
3: 58800
4: 36234
1153881650_1153881653 -10 Left 1153881650 18:9426461-9426483 CCCTGACTCTTCTAAAAGTACAA No data
Right 1153881653 18:9426474-9426496 AAAAGTACAAAAAATTAGCTGGG 0: 447
1: 21391
2: 70366
3: 45592
4: 52124
1153881650_1153881660 29 Left 1153881650 18:9426461-9426483 CCCTGACTCTTCTAAAAGTACAA No data
Right 1153881660 18:9426513-9426535 TGTAGTCCCAGCTACTCAGGAGG 0: 40849
1: 157871
2: 218647
3: 208196
4: 128589
1153881650_1153881655 -2 Left 1153881650 18:9426461-9426483 CCCTGACTCTTCTAAAAGTACAA No data
Right 1153881655 18:9426482-9426504 AAAAAATTAGCTGGGCATGGTGG 0: 12741
1: 68316
2: 142002
3: 198072
4: 178225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153881650 Original CRISPR TTGTACTTTTAGAAGAGTCA GGG (reversed) Intergenic
No off target data available for this crispr