ID: 1153887285

View in Genome Browser
Species Human (GRCh38)
Location 18:9478147-9478169
Sequence TGACTAATGCAGAAATTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153887280_1153887285 3 Left 1153887280 18:9478121-9478143 CCTTAAGCTTAAAGAAGGCTTAG 0: 1
1: 0
2: 1
3: 9
4: 115
Right 1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153887285 Original CRISPR TGACTAATGCAGAAATTGGG GGG Intronic
900365985 1:2312172-2312194 TGACTGAGGCAGAAATGGGTGGG - Intergenic
903305841 1:22412580-22412602 TTCCTAATTCACAAATTGGGTGG - Intergenic
904414976 1:30355161-30355183 TGAATCATGCAGATATTTGGGGG + Intergenic
909302721 1:74033690-74033712 TGATTATGGCAGAAATTGGATGG + Intronic
910680403 1:89857825-89857847 TCAATAATGCAGAAATAGTGGGG - Intronic
911584477 1:99674789-99674811 TGAACAATCCAGAAAGTGGGAGG + Intronic
911775660 1:101808634-101808656 TGATTAATACAGACATTGGAGGG + Intronic
911917829 1:103721808-103721830 TTACCCATGCAGAAAATGGGGGG + Intronic
912284780 1:108357594-108357616 TTATTAATGCAGAAATTATGAGG + Intergenic
915241245 1:154523597-154523619 TGAATAATGAAGAAATGGTGGGG - Intronic
917597898 1:176548017-176548039 TGACTAATACAGACATGTGGAGG + Intronic
918395911 1:184112692-184112714 TGAATAATGCAGAAGTTATGTGG + Intergenic
918890367 1:190258356-190258378 TAACTAGTGCAGTATTTGGGTGG - Intronic
920054197 1:203180867-203180889 TGACAGATGCAGAAATCAGGTGG + Intronic
920805379 1:209229024-209229046 TGTTTAATGCAGAAATTGGCTGG + Intergenic
921256997 1:213350982-213351004 TGACTAATGTAGCAATTGCTGGG + Intergenic
921667255 1:217887829-217887851 TGACTGATGCAGGAATTGGTAGG + Intergenic
1064557339 10:16560524-16560546 TGACTAATGCAAACATGAGGAGG - Intergenic
1066587453 10:36951957-36951979 TGACTATTTCTGAGATTGGGAGG + Intergenic
1066666881 10:37791812-37791834 TGACTACTGCAGCTATTGGCTGG + Intronic
1067517414 10:46963666-46963688 TGAATAATTCAGAAATAGGTAGG - Intronic
1067644834 10:48088163-48088185 TGAATAATTCAGAAATAGGTAGG + Intergenic
1068711240 10:60136429-60136451 TGTCTAATGCAGAGAGTGGCCGG - Intronic
1068741959 10:60483456-60483478 TGAGTAAAGAAGAAAATGGGCGG - Intronic
1069375802 10:67791257-67791279 TGACTAATACAGTTATTGAGAGG - Intergenic
1069600357 10:69701598-69701620 TGACTAATGCTAAAATTAGTGGG - Intergenic
1073756103 10:106582349-106582371 TGACTGATGCAGAGATGGGGAGG - Intronic
1074426318 10:113354618-113354640 TGACTGATGCAGAGATACGGGGG + Intergenic
1075065367 10:119285667-119285689 TGGGTGATGCAGAAATGGGGCGG + Intronic
1076284333 10:129278158-129278180 TGACTAAGGCAGGGAATGGGAGG + Intergenic
1077202713 11:1319581-1319603 TCACAAAAGCAGAAATTGGGGGG - Intergenic
1083009145 11:59378667-59378689 TGACTAATGTAAATATTGGTTGG + Intergenic
1084155572 11:67310944-67310966 TGACTTAGGCAGGACTTGGGCGG - Intronic
1084222061 11:67688305-67688327 TGACTAATACAGTATTTGTGAGG + Intergenic
1084723093 11:70921546-70921568 TGCCGAATTCTGAAATTGGGAGG + Intronic
1088538320 11:110885632-110885654 TGACATATGCAGAAAGTTGGAGG + Intergenic
1090017348 11:123097974-123097996 TGAGTAATGCAGAGACTGGATGG + Intronic
1091084688 11:132709873-132709895 TGACCAATGCTTAAATTAGGGGG - Intronic
1091355143 11:134931892-134931914 TTAGAAATCCAGAAATTGGGAGG + Intergenic
1093833608 12:23797978-23798000 TGAATCATGCAGATATTTGGGGG - Intronic
1095518624 12:43035763-43035785 TGAGTGATGAAGAACTTGGGTGG + Intergenic
1096462101 12:51827520-51827542 TAACAAATGGAGAAATTGGCTGG - Intergenic
1097419719 12:59360012-59360034 GGCCTAATGCAGGAATTGAGGGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104233305 12:126906677-126906699 TGCCTAATACAGAAACTTGGTGG + Intergenic
1104407467 12:128530089-128530111 TGAAAAAGGCAGAAAGTGGGCGG + Intronic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1108738978 13:53314998-53315020 TGTCTTTTGCAGAACTTGGGTGG + Intergenic
1110600062 13:77362881-77362903 TGACTAATGCATAGATTGAATGG - Intergenic
1111735791 13:92137813-92137835 TTACTAATGCAGAAAATGTGTGG + Intronic
1115305292 14:31927692-31927714 TGACTAGGGCAGAGATGGGGAGG - Intergenic
1115651741 14:35407154-35407176 TGCCTTTTGCAAAAATTGGGAGG + Intergenic
1116462762 14:45196813-45196835 TAACTAAGGCAGCAATGGGGAGG + Intronic
1116535506 14:46023655-46023677 TAACAAAAGCAGAAATTGGCAGG + Intergenic
1120714314 14:87823685-87823707 TAAATAATCCAGAAATTGGTAGG + Intergenic
1120977718 14:90264120-90264142 AGACCTATGCAGATATTGGGGGG + Exonic
1121462881 14:94095590-94095612 TTACTAATGCAGAAGTTGAAGGG + Intronic
1125413330 15:39427634-39427656 TGGCCAAAGCAGAAATTGGTTGG - Intergenic
1125461624 15:39912716-39912738 TGACATATGCAGAAATTGTTTGG + Intronic
1128324853 15:66717681-66717703 TGACTGTTGCAGAGATGGGGAGG + Intronic
1128380385 15:67107784-67107806 TGACTATTGTTGAAATTGAGTGG + Intronic
1131790611 15:95960027-95960049 TCAGTATTACAGAAATTGGGGGG + Intergenic
1132222306 15:100113980-100114002 TGAGAAAAGCAGAAATGGGGTGG + Intronic
1132401120 15:101506246-101506268 TCACTGATGCTGAAATTTGGGGG + Intronic
1134035384 16:11026318-11026340 TGCCTACTGAAGAAATTGAGTGG - Intronic
1135849517 16:25950434-25950456 TGAATAATTCATTAATTGGGTGG + Intronic
1137841867 16:51648529-51648551 AGAGTGATGGAGAAATTGGGAGG - Intergenic
1138305939 16:55974499-55974521 TCACTAATGCAGAAATGGATTGG - Intergenic
1140894094 16:79309926-79309948 TGACTAATGCAAATATTCAGAGG + Intergenic
1143066893 17:4256556-4256578 TGACTGATGCAGATCTTGGGGGG + Intronic
1143178703 17:4971065-4971087 AGACTAATGGAGTAAGTGGGTGG - Intronic
1144996895 17:19275906-19275928 TGAGCAATGCAGAAATTGTCAGG - Intronic
1146065209 17:29629442-29629464 TTACTAATGCATAATTTGGCAGG + Exonic
1151528763 17:74690493-74690515 TTGCTAAGGCAGAATTTGGGTGG - Intronic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1154449622 18:14463348-14463370 CTACTAAAGCAGAAATTAGGAGG + Intergenic
1156029625 18:32697027-32697049 GGCATAATGTAGAAATTGGGTGG + Intronic
1156177776 18:34567116-34567138 TGACTAATTCAAAAATTTTGTGG - Intronic
1160006546 18:75072952-75072974 TGTCTAATGCAGAAATCAGCTGG + Intergenic
1160213640 18:76906658-76906680 TGACCAATGCTGTAATTGCGGGG + Intronic
1167824680 19:51961405-51961427 GGAAAAATGCAGAAAATGGGGGG + Intergenic
925235450 2:2273364-2273386 AGACCAATACAGAAAGTGGGTGG + Intronic
926555348 2:14350996-14351018 TGACTGAAGCATAAAGTGGGAGG - Intergenic
926788960 2:16550677-16550699 TGGCTAATGGAGAAAATGTGAGG - Exonic
926799358 2:16645995-16646017 TGAATAATTCAGAAATGAGGAGG + Intronic
927525512 2:23736612-23736634 TGAGCAATGCAGAAGATGGGTGG + Intergenic
927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG + Intergenic
930302672 2:49637131-49637153 TGACTTAAGTAGGAATTGGGAGG - Intergenic
933276337 2:80288305-80288327 TGAGCAAAGCAGAATTTGGGGGG + Intronic
936040281 2:109144753-109144775 TGACTGATGCAGACAGTGTGAGG - Intronic
936174048 2:110203455-110203477 TGACTTATGCTGAACTTCGGTGG - Intronic
937512086 2:122607236-122607258 TCACTATTGCAGAACTGGGGTGG + Intergenic
938807439 2:134819493-134819515 TGACTAATTCAGAAATGAGGTGG - Intergenic
940961658 2:159793690-159793712 TGACTAATCCAGAGATTCTGTGG + Intronic
940972978 2:159913689-159913711 TGGCTAATGCTGAACCTGGGGGG + Intergenic
941239487 2:163018002-163018024 AGACCAATGCAGAAGGTGGGTGG - Intergenic
942432717 2:175931075-175931097 TCTTTAATGTAGAAATTGGGTGG - Intronic
942858329 2:180579128-180579150 TGTCTATTTCAGAAATTGAGAGG + Intergenic
947544638 2:231002235-231002257 TGACTAAGGCAATAATTGTGAGG - Intronic
947756894 2:232572717-232572739 AGACTAATGAAGAAACTGGGAGG + Intronic
947807679 2:232979906-232979928 TGACTCATGCGGAAGTTGCGAGG - Intronic
948169315 2:235888405-235888427 TGACTAATGCAGGAGCTGTGTGG - Intronic
1169453022 20:5728430-5728452 TAAATAAAGCAGAACTTGGGGGG + Intergenic
1171722794 20:28581594-28581616 TGACTAATACAAAAATTATGTGG - Intergenic
1173152740 20:40581799-40581821 TGACAAAGGGAGAAGTTGGGTGG - Intergenic
1178890444 21:36516515-36516537 TGATGAATACAGAAATTGAGAGG - Intronic
1179358277 21:40682292-40682314 TGACCAATACAGAAAGTGGATGG + Intronic
1180296347 22:10940273-10940295 TGACTAATACAAAAATTATGTGG - Intergenic
1180577980 22:16798210-16798232 TTACTGATGCTGAAATTGTGGGG - Intronic
1184104790 22:42361206-42361228 AGACAAATACAGAAATTGGCCGG - Intergenic
949288105 3:2430125-2430147 TTAGAAATGCAGAAATTGGCCGG + Intronic
951658724 3:25038352-25038374 TGTCTAATGGATAAACTGGGAGG + Intergenic
952512781 3:34073915-34073937 GGACTCATGCAGCAATTAGGAGG + Intergenic
952834754 3:37593396-37593418 TGACTATCCCATAAATTGGGTGG + Intronic
953388165 3:42518931-42518953 TGACTGTTGCAGCAATAGGGGGG - Intronic
955624887 3:60908110-60908132 TGCCTAATGCAGAATTCTGGAGG + Intronic
956244610 3:67168395-67168417 TGACAAATTCAGAAACTTGGAGG - Intergenic
956378012 3:68636249-68636271 AGACCTATGCAGATATTGGGGGG + Intergenic
958626398 3:96630065-96630087 TGACTAATGAAGACATTCAGAGG + Intergenic
960932899 3:122872819-122872841 TAATTAATTCAGAAATTCGGGGG - Intronic
962457019 3:135573921-135573943 CGACTTTTGCAGGAATTGGGGGG + Intergenic
963602034 3:147387164-147387186 TGAAGTATGCAGAAGTTGGGGGG - Exonic
965333330 3:167404897-167404919 TAATTAATGCAGAAACTGGTCGG + Intergenic
965365802 3:167798341-167798363 TGGCTAATGCATAGATAGGGAGG + Intronic
966269861 3:178091406-178091428 TGACTGATGCAGTCATTTGGAGG - Intergenic
969189474 4:5505413-5505435 TGACAAGTGTAGAAACTGGGAGG + Intergenic
970366754 4:15366893-15366915 TGAGGAATGGAAAAATTGGGGGG + Intronic
971730649 4:30375335-30375357 TGATTTATGGAGAAATTGGGAGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973640849 4:52901214-52901236 TGAGTGATGCAGAAGATGGGTGG - Intronic
974741296 4:66011764-66011786 TGTCTAATACTGACATTGGGTGG + Intergenic
976858871 4:89638669-89638691 TGACTTATTAGGAAATTGGGAGG - Intergenic
977446015 4:97133481-97133503 AGACTGATGGAGAAATTGGTTGG - Intergenic
978711805 4:111791305-111791327 TGAGTAAAGCAGTAATGGGGAGG + Intergenic
979417357 4:120460391-120460413 AGACCAATGCAGAAGGTGGGTGG + Intergenic
979475791 4:121156327-121156349 TGAATATTGTAGAAAATGGGAGG - Intronic
981469001 4:145108176-145108198 AGAGAAGTGCAGAAATTGGGGGG + Intronic
982049333 4:151484903-151484925 TGAGTCATGCAGAATTGGGGTGG + Intronic
982497664 4:156110815-156110837 TAACTAAGGCAGGAAGTGGGAGG + Intergenic
983500600 4:168495141-168495163 TGAAAAGGGCAGAAATTGGGAGG - Intronic
983680806 4:170351561-170351583 TGACTTATGCAGAAATTTCTAGG + Intergenic
983689114 4:170446506-170446528 TGGGTAATGCAGAATTTTGGGGG + Intergenic
983956410 4:173703653-173703675 TCACTAATGCTCAAATTGTGGGG - Intergenic
984427589 4:179607737-179607759 TGACTAATGGAGAAAATAGTAGG + Intergenic
986376768 5:7140470-7140492 AGGTTAATTCAGAAATTGGGTGG - Intergenic
987332780 5:16871852-16871874 TGACTCATGTAGGAATTGCGGGG - Intronic
987564663 5:19568568-19568590 TGACTAAAGGAGAAAATTGGTGG + Intronic
989577430 5:43001156-43001178 TGTCTTATGCAGAGATTGGAGGG + Intergenic
989581216 5:43034782-43034804 TGTCTTATGCAGAGATTGGAGGG + Intergenic
990214636 5:53516339-53516361 TGAATAATCCTGAAATTTGGCGG - Intergenic
992566097 5:77996700-77996722 GGCCTAATGTAGAAATTTGGCGG - Intergenic
993410580 5:87567910-87567932 AGACCAACGCAGAAAGTGGGTGG - Intergenic
993479428 5:88405548-88405570 TGACTAAAGCATAAAATTGGAGG + Intergenic
994362950 5:98876397-98876419 TTAGTGATGCAGAAATTAGGCGG - Exonic
994963811 5:106640108-106640130 TGTCTAATGCAAAGATTGTGAGG + Intergenic
995090562 5:108170932-108170954 TGAATTATGGAGAAATTGAGAGG - Intronic
997310799 5:132879995-132880017 TGACTGATACAGAAATAGGCTGG - Exonic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
999665251 5:153906080-153906102 TGATGCTTGCAGAAATTGGGAGG - Intergenic
1000152004 5:158512220-158512242 TGATTGAAGCAGAAATGGGGAGG + Intergenic
1001696657 5:173675304-173675326 TGAGTAACTCAGAGATTGGGTGG + Intergenic
1001705723 5:173739995-173740017 TGACTAAAGCAGAATGAGGGAGG + Intergenic
1004733376 6:18380759-18380781 TGTCTTATGCAGGAATTTGGAGG + Intergenic
1006580420 6:35073924-35073946 TGGCTACTTCAGGAATTGGGAGG + Intronic
1008161365 6:48080007-48080029 AGACTGATGTAGAAATTGAGAGG + Intergenic
1009355032 6:62732963-62732985 TGACTAATGCAGAAAATTATAGG - Intergenic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1011914468 6:92487044-92487066 AGAATAAAGCAGAAATTTGGAGG - Intergenic
1012431393 6:99167317-99167339 TGACTAAAGAAAAAATTAGGAGG - Intergenic
1012968197 6:105698133-105698155 TGACTAATGAGGTCATTGGGTGG + Intergenic
1013336507 6:109168474-109168496 TGAAGTATGCAGAAATTGAGTGG - Intergenic
1014167700 6:118244482-118244504 TGACTTATGCAGAAATTTCTAGG + Intronic
1014577795 6:123094829-123094851 TCACTATGGCAGAGATTGGGTGG - Intergenic
1015097524 6:129433224-129433246 TGCATAATGCAGAAAATTGGAGG + Intronic
1016704332 6:147089214-147089236 TGAATAATGCCTGAATTGGGTGG + Intergenic
1017524479 6:155230468-155230490 TGACCAGTGCCGAAAGTGGGGGG - Intronic
1017662975 6:156691755-156691777 TGACTAAAGTAGGAATTGGTAGG - Intergenic
1018491431 6:164297812-164297834 TGACAAAAGCAGCAATGGGGTGG - Intergenic
1018572919 6:165229613-165229635 TGACTAGTGCCAAAATTTGGAGG + Intergenic
1020408939 7:7868785-7868807 TCACTGATACAGAAATTAGGGGG - Intronic
1022896725 7:34757641-34757663 TGATCAAGGCAGAAACTGGGGGG - Intronic
1022948295 7:35310081-35310103 TGGCTAATGCAGAAAGTGTAGGG + Intergenic
1024919073 7:54537992-54538014 TTGCTAATGAAGAAATTGAGAGG + Intergenic
1025026577 7:55521486-55521508 TCTCTAAAACAGAAATTGGGGGG - Intronic
1027007684 7:74709403-74709425 TGAATAATACAAAAATTGGCTGG - Intronic
1028134525 7:87211463-87211485 TGAGAAATGCAGAACTTTGGAGG - Intronic
1028609573 7:92695203-92695225 GGACTAAGGCAGAAATTAGGGGG + Intronic
1029477317 7:100792655-100792677 GGACTAAGGCAGAAATTCGAGGG - Intronic
1031633490 7:124073153-124073175 TGACTCATTCATAATTTGGGTGG - Intergenic
1031789075 7:126076879-126076901 TGAATAATGAAGAGCTTGGGGGG + Intergenic
1033366494 7:140675934-140675956 TGGGTAGTGCAGGAATTGGGAGG + Intronic
1034899674 7:154899825-154899847 TGACTAATGCAGAAGCGTGGAGG + Intergenic
1035627982 8:1088185-1088207 GGACTAGTGCAGAAATTGCAGGG - Intergenic
1038068180 8:23984803-23984825 TGAGTACTGCAGAAGTTGGTTGG - Intergenic
1039303920 8:36240571-36240593 AGACTAATGCAGAAATTTCATGG + Intergenic
1042951204 8:74202331-74202353 TCACTCATGCAGTTATTGGGAGG - Intergenic
1046376995 8:113396551-113396573 TGACTAGTGAATAAATTTGGGGG + Intronic
1050965034 9:11788692-11788714 TCACTGATGCTGAAATTTGGGGG - Intergenic
1057923187 9:99116674-99116696 TGGCTACTGAAGAAAGTGGGGGG - Intronic
1203618904 Un_KI270749v1:99465-99487 TTACTAAAGCACAAATGGGGAGG - Intergenic
1185889853 X:3814455-3814477 TGACCGATTTAGAAATTGGGTGG + Intergenic
1185966525 X:4611795-4611817 TGTCTAATGCTGAAATTGCAAGG + Intergenic
1188226877 X:27610776-27610798 TGGCTGCTGCAGAAATTGGATGG + Intronic
1190057988 X:47193185-47193207 TGCATAATTCATAAATTGGGTGG + Intronic
1190662324 X:52666192-52666214 TGAAAAATGCAGACATTCGGGGG + Intronic
1194033559 X:88844017-88844039 TGGCAAATGCAGAACTTGGCAGG + Intergenic
1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG + Intronic
1196190603 X:112790471-112790493 ACACTTAGGCAGAAATTGGGGGG + Intronic
1197008989 X:121537356-121537378 TAAAAAATGCAGAAATTGAGAGG - Intergenic
1197850199 X:130850491-130850513 TGAATAATGGAGAAATTTGATGG - Intronic
1197881742 X:131173786-131173808 TGATTAAGGGGGAAATTGGGAGG + Intergenic
1198257251 X:134934468-134934490 TAGCAAATGCAGATATTGGGAGG + Intergenic
1198265481 X:135004613-135004635 TGTCTTATGCAGAAACCGGGAGG + Intergenic
1198344409 X:135745668-135745690 TGACAAATGCAGGACTTGGCAGG - Intergenic
1199255034 X:145709809-145709831 TTACTAATACAGAATTTGAGAGG + Intergenic