ID: 1153890088

View in Genome Browser
Species Human (GRCh38)
Location 18:9505357-9505379
Sequence TAGGGTGTGGAGAAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 661}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153890088_1153890095 11 Left 1153890088 18:9505357-9505379 CCCTGCCTCTTCTCCACACCCTA 0: 1
1: 0
2: 5
3: 63
4: 661
Right 1153890095 18:9505391-9505413 TCTAAATTCTTTTGACACCTAGG 0: 1
1: 0
2: 0
3: 31
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153890088 Original CRISPR TAGGGTGTGGAGAAGAGGCA GGG (reversed) Intronic
900339433 1:2181071-2181093 TGGGGTGGGGAGAAGCAGCAGGG - Intronic
900586940 1:3437134-3437156 TGGGGTGTGGAGCAGTGGCTGGG + Exonic
900822493 1:4900053-4900075 AAGGGGCTGGAGATGAGGCAGGG + Intergenic
900911786 1:5601770-5601792 TGGGGTGTGGAGACGCGGCACGG + Intergenic
900911802 1:5601831-5601853 TGGGGTGTGGGGACGCGGCATGG + Intergenic
900911819 1:5601892-5601914 TGGGGTGTGGAGACGCGGCATGG + Intergenic
900911824 1:5601912-5601934 TGGGGTGTGGAGACGCGGCATGG + Intergenic
901118708 1:6872162-6872184 TTGGGAGTAGAGAAGAGGTATGG - Intronic
901535832 1:9882619-9882641 CAAGGTGTGGAGCAGAGGCTGGG + Intronic
901603956 1:10444576-10444598 TATGGTGAGGAGAAGGGGCAAGG + Intronic
901775407 1:11557157-11557179 CAGGGAGTGGAGAAGAGCCCAGG - Intergenic
902530582 1:17088136-17088158 TGGGGAGGGCAGAAGAGGCACGG + Intronic
902550837 1:17218761-17218783 AAGGGAGGGGAGAAGGGGCAAGG + Intronic
902768273 1:18631048-18631070 GAAGGCGTGGAGAAGAGGGAGGG + Exonic
902939969 1:19793944-19793966 GAGGGTTTGGAGCAGAGGAAGGG - Intronic
903014702 1:20354292-20354314 AAGGGTGGGGAGGAGAGGGATGG + Intronic
903675304 1:25060894-25060916 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
903946568 1:26967774-26967796 TGGGGTGTGGAGGTGAGGAAGGG - Intergenic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
904115432 1:28158376-28158398 TAAGGAGTTGAGAAGAGACAGGG + Intronic
904207650 1:28865179-28865201 GAGGGAGAGGAGATGAGGCACGG - Intergenic
904341468 1:29837569-29837591 AATGGTGTGGGGAGGAGGCATGG - Intergenic
904479558 1:30785449-30785471 TGGGTGGTGGAGAAGAGGCTTGG - Intergenic
904493938 1:30876527-30876549 GAGGGTGTTGAGAAGGGACAGGG - Intronic
904797126 1:33064948-33064970 TAGATTGTGAAGAAGAGGCAGGG + Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
904948281 1:34215121-34215143 TGGGGTGGGGAGAAGAATCAAGG + Intronic
905856891 1:41320302-41320324 CAGGGGGTGGGGAAGAGGAAGGG + Intergenic
905867952 1:41386522-41386544 AAGGGAGAGGAGGAGAGGCAGGG - Intergenic
906137625 1:43510684-43510706 AAGGGTCTGGAAAAGAGGCTTGG - Intergenic
906645262 1:47470162-47470184 TGGGCTGTGGGGAGGAGGCACGG + Intergenic
906682315 1:47737190-47737212 CAGGGTGTGGAGAGGAGACATGG + Intergenic
907222190 1:52915087-52915109 CAGGGTGTGGGGAAGAGAGATGG + Intronic
907328747 1:53657881-53657903 GAGGGTGCAGAGAAGGGGCAAGG - Intronic
907464074 1:54623584-54623606 GAGGGTGTGGGGAAGAGGATTGG - Intronic
907663371 1:56413905-56413927 GAGGGTGTGAAGCAGAGGAAAGG - Intergenic
907875883 1:58487900-58487922 TAGGATCAGGAGAAGAGGTACGG - Intronic
908284591 1:62581446-62581468 TAGGGTCAGGACAAGAGTCAAGG + Intronic
908407573 1:63830265-63830287 AAGGTGGTGGAGAAGAGGCTGGG + Intronic
908680443 1:66655075-66655097 GTTGGTGTTGAGAAGAGGCATGG - Intronic
908762610 1:67525962-67525984 TGAGGTGTGGAGAAAAGGTAAGG - Intergenic
909772052 1:79436046-79436068 GAGGGTGTGGGGAAGAAGAATGG + Intergenic
911463743 1:98224245-98224267 TAGAGTGAGGAGAAGCGGGAAGG + Intergenic
911777469 1:101832552-101832574 GTGGGTGTGGAGTAGGGGCAGGG + Intronic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
913034141 1:114945464-114945486 TAAGATTTGGAGAAGAGGTAGGG + Intronic
913264599 1:117032056-117032078 TAGGATGTGGAGCAGAGGGATGG + Intronic
913688708 1:121257977-121257999 TAGGGGGTGGAGTTGAGGAAGGG + Intronic
913958686 1:143323420-143323442 CAGGGTCAGGACAAGAGGCAGGG + Intergenic
914053003 1:144148800-144148822 CAGGGTCAGGACAAGAGGCAGGG + Intergenic
914126194 1:144817741-144817763 CAGGGTCAGGACAAGAGGCAGGG - Intergenic
914148892 1:145022299-145022321 TAGGGGGTGGAGTTGAGGAAGGG - Intronic
914461643 1:147890881-147890903 TAGGGTGGGTGGAGGAGGCAGGG + Intergenic
914849263 1:151302006-151302028 CAGGGTGAGGACAAGAGACATGG + Intronic
914999143 1:152572166-152572188 TAGTGTGTGGAAAAGAGACATGG - Intronic
915644596 1:157259904-157259926 TGGGGTGTGGGGAGGAGGGAGGG + Intergenic
915835249 1:159171393-159171415 TCGGGTGTGGATCAGAGGGAGGG - Intergenic
915980102 1:160415195-160415217 TAGCATGGGGAGAAGAGGCCTGG + Intronic
916142284 1:161710521-161710543 TGTGGTTTGGAGAAGAGGGAGGG - Intronic
916291763 1:163174660-163174682 TATGCTGATGAGAAGAGGCAGGG + Intronic
916502358 1:165397752-165397774 TAGGGTGTGGAGAAGGAGTTAGG + Intergenic
917497577 1:175555206-175555228 TAGGGGGTGGGGAAGAGCAAAGG - Intronic
917789178 1:178488442-178488464 CAGGGTCTGGGGAAGTGGCAAGG - Intergenic
918429932 1:184449190-184449212 TAGGGTGGGGGGAAGGGGGAGGG - Intronic
919468244 1:197948214-197948236 TAGGGGATGGAGAAGAGGATTGG + Intergenic
919786260 1:201260264-201260286 CAGGGTCTGGGGAAGAGGCTGGG - Intergenic
920476031 1:206276477-206276499 TAGGGGGTGGAGTTGAGGAAGGG + Intronic
920821961 1:209389735-209389757 TAGTGTGGGGTGGAGAGGCAAGG + Intergenic
920822892 1:209398021-209398043 TAGGATGTGGAGGTGAGGAAAGG - Intergenic
920986149 1:210891390-210891412 TGGGGTGAGGAGAAGGGGGAGGG + Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
922378147 1:224990923-224990945 AAGGATGTGGAGAAAAGGGAAGG - Intronic
922612562 1:226940977-226940999 CAGAGTTTGGAGAAGAGGAAAGG - Intronic
922886319 1:229023656-229023678 AACGGCGTGGAGCAGAGGCAAGG + Intergenic
922974630 1:229773856-229773878 GAGGATGTGGAGAAAAGGGAAGG + Intergenic
923256009 1:232222275-232222297 CAAGGTGTAGGGAAGAGGCATGG + Intergenic
924520585 1:244802866-244802888 TTGGCTCTGGAGATGAGGCATGG - Intergenic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1063116656 10:3076523-3076545 GAGGGTGTGGAGGACAGGGAGGG - Intronic
1063225725 10:4013287-4013309 TAGGGGGTAGAGAAGAGGAGGGG - Intergenic
1063226609 10:4020907-4020929 GAGGATGTGGAGAAAAGGGAGGG - Intergenic
1063448697 10:6136689-6136711 TGGGGTGTGGAGAAGAGGAGAGG - Intergenic
1063727542 10:8655113-8655135 GAGGTTGTGGAGAAAAGGAAAGG + Intergenic
1063728046 10:8661461-8661483 GAGGATGTGGAGAAAAGGAAAGG + Intergenic
1063730392 10:8690097-8690119 TGGGGTGTGGGGAGGAGGGAGGG - Intergenic
1064136587 10:12755953-12755975 AGGGGAGTGGAGAAGAGACAGGG - Intronic
1064510974 10:16091043-16091065 TGGGGTGGGGAGAGGAGGGAGGG + Intergenic
1065266740 10:23984159-23984181 TAGGGTGGAGTGAAGAGCCATGG - Intronic
1066615687 10:37291770-37291792 TAGGATGTGGAGAAAAAGCTCGG - Intronic
1067557604 10:47283565-47283587 TGGGGTGTGGAAAAGGGCCATGG + Intergenic
1067675492 10:48371956-48371978 CAAGGCGTGGAGAAGGGGCATGG + Intronic
1067973023 10:50992651-50992673 TGGGGTGTGCAGAGGAGGCTGGG + Intronic
1069036263 10:63648931-63648953 TAGCGAGTGGAGAGGAGGCCGGG + Intergenic
1069915277 10:71783302-71783324 GAGGGTGGAGAGAAGAGACAGGG - Intronic
1070422166 10:76247798-76247820 TAGGGTGTCAAGAAGAGGGTAGG - Intronic
1070585845 10:77765440-77765462 AAGGGTGTGGAGAATAAGCCAGG + Intergenic
1070682821 10:78461139-78461161 TAGCGGGTGGATAAGAGGCAAGG + Intergenic
1070828318 10:79403886-79403908 GGGGGTGTGGAGAGGAGGGAAGG + Intronic
1070928717 10:80245140-80245162 TAGGGTGTAGAGAGGAGACGGGG - Intergenic
1071917469 10:90310699-90310721 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1072721032 10:97781270-97781292 GAGGGTGTGGAGAAGCGGCATGG + Intergenic
1073147234 10:101288824-101288846 TGTGGTGTGGAGTAGAGGCAGGG - Intergenic
1073265802 10:102227776-102227798 TAAGATCTAGAGAAGAGGCAGGG - Intronic
1073592143 10:104767660-104767682 AAGGGAGTGGAGAAGGGGAAGGG - Intronic
1073611081 10:104943961-104943983 TAGGGTGGAGTGAAGTGGCATGG + Intronic
1074267628 10:111920638-111920660 GAGGGTGTGAAGAGGAGGAAGGG - Intergenic
1075080525 10:119380597-119380619 TGGGGTGGGGAGTAGAGGCTGGG + Intronic
1075213895 10:120515308-120515330 GAGTGTGAGGAGAAGAGGCAAGG - Intronic
1075500890 10:122973150-122973172 TTGGGGGTGAAGAAGAGGGAAGG + Intronic
1075576416 10:123580853-123580875 CAGGTAGGGGAGAAGAGGCATGG - Intergenic
1076236622 10:128868549-128868571 TAGGGAGGGGAGAAGAGTGAAGG + Intergenic
1076426497 10:130371031-130371053 TTGTGTGTGGAGGATAGGCATGG + Intergenic
1076891081 10:133283729-133283751 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1076891089 10:133283766-133283788 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1078569311 11:12443865-12443887 AAGGCTTTGGAGAAGAAGCAGGG - Intronic
1078703056 11:13708398-13708420 TGGGGTGAGGAGAAGAGGGAGGG - Intronic
1079396636 11:20069305-20069327 TTGGATGTGGAGGAGAGGTAAGG + Intronic
1079424512 11:20327371-20327393 TAGAATGGGGAGAAGAGGAAGGG - Intergenic
1080382384 11:31787155-31787177 TAGGGTGTGGGCAGAAGGCAAGG + Exonic
1080561212 11:33464875-33464897 TGGGGTTCGGAGAAGATGCAGGG - Intergenic
1080811491 11:35708761-35708783 TGGGGTGTGGGGAGGAGGGAGGG + Intronic
1080985652 11:37461237-37461259 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1081268122 11:41052130-41052152 TAGGGTGTGCAGTGGATGCAAGG - Intronic
1082785965 11:57316843-57316865 AAGGGTTTGCAGGAGAGGCATGG - Intronic
1083394590 11:62381435-62381457 TAGATTGTGAAGAATAGGCAGGG - Intronic
1083635913 11:64120947-64120969 TAGGGTGGGGAGAGGAGACAGGG - Intronic
1083852901 11:65378298-65378320 TGGAGTGGGAAGAAGAGGCAGGG - Intronic
1083964654 11:66035975-66035997 AAGGGCATGGAGAAGAGGAAGGG - Intergenic
1084032430 11:66488764-66488786 GAGGATGTGGAGATGAAGCAGGG - Intronic
1084238843 11:67805428-67805450 TAGGGTGAGGAGGAGAGTCGTGG + Intergenic
1084410157 11:69002253-69002275 AAGGGTGGGGTGAAGGGGCAGGG - Intergenic
1085198485 11:74686873-74686895 AGGGGTGTGGAGAAGTGGGAAGG + Intergenic
1085349050 11:75786591-75786613 GAGGGTGTTGAGAAGATGCTGGG - Intronic
1085393061 11:76192383-76192405 TAGGAAGGGGAGAAGAGGCAGGG + Intronic
1085401867 11:76240320-76240342 TCAGGAGTGGAGAAGAGGGAAGG - Intergenic
1085537895 11:77236324-77236346 TGGGGTGGGGAGACGGGGCAGGG - Intronic
1085819563 11:79777704-79777726 TAGGGTGTGCAATAGAGGCTTGG - Intergenic
1085976826 11:81665913-81665935 GAGTGTGTAGAGGAGAGGCAGGG + Intergenic
1086428284 11:86708888-86708910 TGGAATGTGGAGAAGAGGAATGG + Intergenic
1086501213 11:87455866-87455888 TAGGGTGAAGACAAGAGCCAGGG - Intergenic
1086913133 11:92496334-92496356 GAGGGTGCGGTGGAGAGGCAGGG - Intronic
1087113858 11:94502255-94502277 TAGTGTATGGTGAAGAGGAAAGG - Intergenic
1088871576 11:113894654-113894676 GAGGGAGTGCAGAAGAGGAACGG - Intergenic
1088897809 11:114091393-114091415 CAGGGGGTGGAGGAGAGGAAGGG - Intronic
1089089378 11:115856782-115856804 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1089970139 11:122686681-122686703 TAGGGTAGGAAGAAGAGACAGGG - Intronic
1090015713 11:123084769-123084791 GATGGTGTGAAGAAGAGGAAAGG + Intronic
1090172063 11:124613829-124613851 GAGGATGGGGAGAGGAGGCAGGG - Intronic
1090640037 11:128722272-128722294 CAGGGTATGGAGGAGAGGAAGGG + Intronic
1090940035 11:131379329-131379351 GAGGATGGGAAGAAGAGGCAGGG + Intronic
1091332929 11:134744678-134744700 GAGGGGGTAGAGAAGAGGCAAGG + Intergenic
1091977511 12:4837257-4837279 CAAGGTATGGAGAAGAGACACGG - Intronic
1092730564 12:11529647-11529669 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1092972644 12:13712229-13712251 TAGGGTGGGGGGAAGGGGGAGGG + Intronic
1093378745 12:18463952-18463974 TGGGATGTGAAGAAGAGGAAAGG - Intronic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1094371922 12:29748426-29748448 TAAGCTTTGGGGAAGAGGCAGGG - Intronic
1094413211 12:30190171-30190193 AAGGGGGTGGAGGGGAGGCAAGG - Intergenic
1094874718 12:34627809-34627831 TAGATTGTGAAGGAGAGGCAGGG - Intergenic
1095302209 12:40598050-40598072 TAAGGTATGGAAAGGAGGCAAGG + Intergenic
1095609920 12:44115308-44115330 TCGGGTGGGGAGAAGGGGGAGGG + Intronic
1096452287 12:51754055-51754077 TGGGGAGGGTAGAAGAGGCAGGG - Intronic
1096528996 12:52231811-52231833 TAGGGTCAGGAGGGGAGGCAGGG + Intergenic
1096630315 12:52922268-52922290 TAAGGTGGGGAGGAGAGACATGG - Intronic
1097086898 12:56475546-56475568 TAGGATGGGGACAAGAGGAATGG - Exonic
1097520399 12:60661694-60661716 TAGGGTGTGGTGGAAAGGAAGGG + Intergenic
1097774907 12:63634063-63634085 TAGGGTGCGGGGAAGGGGGAGGG + Intronic
1097944252 12:65349049-65349071 TGGGGTGGGGAGAAGGGGGAGGG - Intronic
1098322647 12:69261858-69261880 TCAGGGGAGGAGAAGAGGCATGG - Intronic
1099143423 12:79008817-79008839 CACGGTGTGGAGAAAAGACATGG - Intronic
1100423533 12:94460301-94460323 AATGGTGTGGGGAAGAGGGAAGG - Intergenic
1101231186 12:102743240-102743262 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1101364621 12:104060289-104060311 GAGAGTTTGGAGAAGAGGGATGG - Intronic
1101629447 12:106478817-106478839 TTGGGTGAGGAGGAGAGACAAGG - Intronic
1101654796 12:106710480-106710502 TAAGGTGTGGAGTGGAGGAATGG - Intronic
1101805948 12:108063822-108063844 TGGGGTTGGGAGAAGAGGGAAGG + Intergenic
1102487432 12:113267811-113267833 GAGGGTGTGGAGATGTGTCATGG - Intronic
1102494121 12:113307464-113307486 CAGAGGGTGGGGAAGAGGCAGGG + Intronic
1102755402 12:115335503-115335525 TAGTGGGTGGAGAGGAGCCAGGG + Intergenic
1102782548 12:115577849-115577871 TAGGGTGGTGCAAAGAGGCAGGG + Intergenic
1103451314 12:121031379-121031401 GAGGGTGAGGAGGAAAGGCAGGG - Intronic
1103743346 12:123106107-123106129 TGGGGTGAAGAGAAGAAGCAGGG - Intronic
1104159570 12:126165269-126165291 AGGGGTGTGGAGCAGAAGCAGGG + Intergenic
1104280439 12:127371893-127371915 TGGTGTGGGGAGAAGAGGCTGGG - Intergenic
1104667202 12:130656073-130656095 GAGGGTGGGGAGAAGGGACATGG + Intronic
1104747845 12:131221230-131221252 TTGGGTCTGGGGAAGAGCCAGGG + Intergenic
1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG + Intergenic
1106082224 13:26509989-26510011 TAGATTGTGAAGAAAAGGCAGGG + Intergenic
1106241056 13:27914066-27914088 ACAGGTGTGGAGAAGGGGCAGGG - Intergenic
1106287119 13:28327868-28327890 AAGGGTCTGGTTAAGAGGCAGGG - Intronic
1106415654 13:29543794-29543816 GAGGGGGTGGAGAGGAGGCAAGG + Intronic
1106623537 13:31395086-31395108 TATGGTGTGGGAAAGAGGCACGG + Intergenic
1106693546 13:32145885-32145907 TGGGGAATGGAGCAGAGGCAGGG - Intronic
1109409739 13:61946238-61946260 TGGGGTGTGGGGAAGGGGGAGGG + Intergenic
1110141885 13:72140186-72140208 TAGGGTGTTGGGAAGAGAGAGGG + Intergenic
1110255928 13:73433957-73433979 GAGGGGGAGGAGAAGAGGGAGGG + Intergenic
1110653073 13:77964628-77964650 TGGGGTGCGGAGAAGAAGGAGGG + Intergenic
1110708754 13:78626707-78626729 GAGGGGCTAGAGAAGAGGCAAGG + Intronic
1112724086 13:102282037-102282059 CAGGGTTAGGAGAAGCGGCAAGG - Intronic
1113249283 13:108433829-108433851 TATGGGGTGGAGGAGAGGTATGG - Intergenic
1113278109 13:108757620-108757642 TGGGGTGGGGAGAAGGGGGAGGG - Intronic
1113614743 13:111672090-111672112 TCCTGTGTGGGGAAGAGGCATGG + Intronic
1113620212 13:111757004-111757026 TCCTGTGTGGGGAAGAGGCATGG + Intergenic
1114265703 14:21071406-21071428 CAGGGAGTGGAGGAGGGGCAGGG + Intronic
1114645676 14:24254821-24254843 TCCGCTGTGGAGAAGAGGCATGG + Exonic
1114922910 14:27357681-27357703 TGGGGTGGGGAGAGGAGGGAGGG - Intergenic
1114939935 14:27596454-27596476 TGGGGTGGGGAGAGGAGGGAGGG - Intergenic
1115629425 14:35228927-35228949 AAGGCTGTGGAGAAAAGGGAAGG - Intronic
1115885149 14:37962979-37963001 GAGGGTGGGGAGGAGAGGTAAGG - Intronic
1116358342 14:43960080-43960102 TGGGGTGTGGGGAGGGGGCAGGG + Intergenic
1116390374 14:44384128-44384150 GATGGGGTGGAGAAGAGGAAAGG + Intergenic
1116390920 14:44388351-44388373 GATGGGGTGGAGAAGAGGAAAGG + Intergenic
1116515009 14:45794751-45794773 TGGGGTGGGGAGAAGGGGGATGG - Intergenic
1117284504 14:54273887-54273909 TGGGGTGAGGAGAAGGGGGAGGG - Intergenic
1117513269 14:56473774-56473796 GAGGGGGTGGAGAGGAGGCATGG - Intergenic
1117670568 14:58101806-58101828 GAGGGTGTGGAGAGGAGGGCAGG + Intronic
1117800661 14:59441306-59441328 TAGGTAGTGGAGAAAAGTCAGGG - Intronic
1117847290 14:59924598-59924620 TAGGGTTTGGAGCAAAAGCAGGG - Intronic
1117886981 14:60374722-60374744 TGGGGTGGGGAGAGGAGGGAGGG - Intergenic
1118310176 14:64686158-64686180 CAGGGGGAGGAGAGGAGGCAGGG - Intergenic
1118322238 14:64759933-64759955 TCTGGTTTGGGGAAGAGGCAGGG + Intronic
1118454046 14:65929330-65929352 TGCGGGGTGGAGAAGAGGCTGGG + Intergenic
1118567178 14:67154311-67154333 GAGGGTGTGGGGAATAGGAAAGG - Intronic
1118782478 14:69017918-69017940 TGGGGTGGGGTGGAGAGGCAGGG - Intergenic
1118947309 14:70399406-70399428 GAGAGTGTGGGGAGGAGGCAGGG - Intronic
1119666746 14:76490545-76490567 TAAGGTTTGGAGAAGTTGCATGG + Intronic
1120608402 14:86608617-86608639 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1121370487 14:93353960-93353982 TAGGGTATGGAAAATAGCCATGG + Intronic
1121395164 14:93615371-93615393 GAGGGTGGGGAGAAGAGGGAGGG - Intronic
1122043588 14:99007700-99007722 GAGGGTGAGGGGATGAGGCAGGG + Intergenic
1122051777 14:99065731-99065753 TAGGGGGTGAAGAAGAGGTCAGG - Intergenic
1123035309 14:105469550-105469572 TGGGGTGTTGGGAAGAGGCCTGG + Intronic
1123508248 15:20968191-20968213 TGGGGTGGGGAGAGGAGGGAGGG - Intergenic
1123565469 15:21541940-21541962 TGGGGTGGGGAGAGGAGGGAGGG - Intergenic
1123601733 15:21979229-21979251 TGGGGTGGGGAGAGGAGGGAGGG - Intergenic
1124073503 15:26419337-26419359 CAGGTTGTGGAGAAAAGGGAAGG + Intergenic
1125290069 15:38136810-38136832 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
1126099282 15:45110163-45110185 TAGGGTGGGGAGAGGAGGGAAGG + Intronic
1126254222 15:46606134-46606156 GAGCGTGGAGAGAAGAGGCAAGG + Intergenic
1126575550 15:50193014-50193036 TAAGGTTGGGAGAAGAGGTAGGG - Intronic
1126812526 15:52422390-52422412 TAGGGTGGGGAGTAGGGGGAAGG - Intronic
1126890952 15:53203675-53203697 CAGGGTGAGGAGAAGAGTGAGGG - Intergenic
1128223294 15:65983477-65983499 TAGGGTGTGGAGTTCAGGCATGG + Intronic
1128381142 15:67113997-67114019 TTGGCGGTGGAGAAGTGGCAGGG + Intronic
1128581350 15:68812357-68812379 AAGAGTGTGGAGAAGGGGCTGGG + Intronic
1128692169 15:69733042-69733064 AAGGGTGTGGAGAAGGGGACAGG - Intergenic
1129461014 15:75700109-75700131 TAGCCTGTGGAGCAGCGGCAGGG + Intronic
1129550825 15:76447237-76447259 TAGGATGAGGAAAAGAAGCATGG - Intronic
1129723807 15:77891616-77891638 TAGCCTGTGGAGCAGTGGCAGGG - Intergenic
1130010481 15:80149523-80149545 TAGGGTGGGGAGAAGGGGATTGG - Intergenic
1130013609 15:80171235-80171257 TGGGGTGGGGGGAAGAGGGAGGG - Intronic
1130050329 15:80478968-80478990 AAGGGTGTTGAGGCGAGGCAGGG + Intronic
1130310566 15:82750339-82750361 TAGGGAGTGGAGAAAGGGCCGGG - Intergenic
1130754423 15:86747619-86747641 TGGGGTGTGGGGAGGAGGGAGGG - Intronic
1131451330 15:92542658-92542680 AAGGGTGAGGAAAAGGGGCAAGG + Intergenic
1131580327 15:93636611-93636633 TCGGGTGTGGGGAAGGGGGAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1202973842 15_KI270727v1_random:269034-269056 TGGGGTGGGGAGAGGAGGGAGGG - Intergenic
1132464107 16:69854-69876 TAGGGTGATGAGGGGAGGCAGGG - Intronic
1132545527 16:531418-531440 TAGGGAGTGGGGATCAGGCAGGG - Intronic
1132664728 16:1076208-1076230 TAGGGTATGGGGGAGAGGGAGGG - Intergenic
1133015703 16:2938464-2938486 CAGGCTGTGGGGCAGAGGCAGGG + Intronic
1133270532 16:4609062-4609084 GAGGGGGTGGGGAGGAGGCAGGG + Exonic
1134841257 16:17403820-17403842 TTGTGTCTGGAGAAGAGACAAGG - Intronic
1135324132 16:21515277-21515299 CAGGGTGTGAAGGAGAGGCTCGG - Intergenic
1136006204 16:27330991-27331013 TGTGATGTGGAGAAGAGGCAGGG + Intronic
1136025547 16:27465953-27465975 TAGGGTGTGTAGAAGGGGCCTGG - Intronic
1136035927 16:27540114-27540136 TCTGGTGTGGGGAAGAGGGAAGG - Intronic
1136122207 16:28145351-28145373 CAGGGTGGGGAGAAGAGGAGGGG - Intronic
1136335612 16:29608549-29608571 CAGGGTGTGAAGGAGAGGCTGGG - Intergenic
1136374444 16:29857018-29857040 TAGGGTTTGGTGAAGGGGCTGGG - Intergenic
1136749386 16:32619413-32619435 CAGTGTTTGGAGAAGAGCCAGGG + Intergenic
1136773127 16:32858304-32858326 CAGGGTCAGGACAAGAGGCAGGG - Intergenic
1136897488 16:34003215-34003237 CAGGGTCAGGACAAGAGGCAGGG + Intergenic
1138230845 16:55335020-55335042 GAGGGTGGGGAGAGGAGGCATGG - Intergenic
1138412324 16:56850440-56850462 CAGGGAGTGGAGAAGGGGCCTGG - Intergenic
1139029883 16:62867256-62867278 GAAGGTCTGGAGAAGTGGCAGGG - Intergenic
1139547370 16:67655979-67656001 TAGGGTGTGGGGAGCGGGCAGGG + Intronic
1140920399 16:79532210-79532232 TGGAGTGTGGAGTAGAGACATGG + Intergenic
1141012465 16:80415722-80415744 GAGGGTGCAGAGAGGAGGCATGG - Intergenic
1141435869 16:83999389-83999411 TGCGCTGTGGAGAGGAGGCACGG + Intronic
1141754711 16:85983420-85983442 TAGTGTGGGGAGATGAGGGATGG + Intergenic
1141810123 16:86370523-86370545 CAGGGAGTAGAGAAGACGCATGG + Intergenic
1142036340 16:87864385-87864407 CAGGGTGTGAAGGAGAGGCCGGG - Intronic
1142225936 16:88877686-88877708 GAGGGGGTGCAGCAGAGGCAGGG - Intronic
1142396130 16:89832685-89832707 CACGGTGTGGAGATGAGGCCAGG + Intronic
1203051518 16_KI270728v1_random:878627-878649 CAGTGTTTGGAGAAGAGCCAGGG + Intergenic
1203075552 16_KI270728v1_random:1120414-1120436 CAGGGTCAGGACAAGAGGCAGGG - Intergenic
1203116391 16_KI270728v1_random:1495175-1495197 TAGGGTGTTGAGAATAAACAGGG + Intergenic
1142562945 17:821846-821868 TAGATTGTGGTGAAGAGACAGGG - Intronic
1142782302 17:2190646-2190668 TAAGGTCTGGAGACCAGGCAAGG + Intronic
1142907540 17:3055040-3055062 AAGGCTGTGGAGAAAAGGGAGGG - Intergenic
1142927025 17:3249219-3249241 AAGGCTGTGGAGAAAAGGGAGGG + Intergenic
1143176069 17:4955915-4955937 TGGGGTTTGGAGCAGAGACAGGG - Intronic
1143395958 17:6596357-6596379 TGGGGTGGGGAGGAGAGGCATGG + Intronic
1143701630 17:8664955-8664977 TGGGGTGGGGGTAAGAGGCAGGG + Intergenic
1143704539 17:8687548-8687570 AAGGGAGTGGAGAAGAGGGGAGG - Intergenic
1143775241 17:9195080-9195102 GAGGGGGTGGGGAAGAGGCCAGG - Intronic
1144300104 17:13915504-13915526 GAGGGAGAGGAGAAGAGGCCTGG - Intergenic
1144414026 17:15029363-15029385 TAGGGAGGGGAGAAGAGTAAAGG - Intergenic
1145939460 17:28735063-28735085 TAGGGGGAGGGGAGGAGGCAGGG - Intronic
1146279908 17:31538245-31538267 GAGGGTGGGCAGAAGAGGCCTGG + Intergenic
1146742541 17:35299147-35299169 TAGGTTGAGGAGCAGATGCAGGG - Intergenic
1146954778 17:36931182-36931204 TAGACTGGGGAGAAGAGGCAGGG - Intergenic
1147139477 17:38453336-38453358 TAGGGTGTGCAGCAGAGTGAGGG + Intronic
1147542782 17:41374843-41374865 GAGGGTCTGGAGAATAGGCCAGG + Intronic
1148075364 17:44932558-44932580 TAGGGATTGGAGCAGAAGCAAGG + Intronic
1148194215 17:45701634-45701656 GGGGGTGTGGAGGAGAGGGAAGG - Intergenic
1148194223 17:45701655-45701677 TGGGGTGGGGAGGAGAGGGAAGG - Intergenic
1148472312 17:47902595-47902617 TAGGGTGTGGAAAAAAGATAAGG + Intronic
1148853736 17:50567360-50567382 TGGGTGGTGGAGAAGAGACAGGG + Intronic
1148864063 17:50619477-50619499 GAGGGGGTGGGGAAGAGGGAAGG - Intronic
1149120341 17:53155881-53155903 CAGGCTGTGGAGAAAAGGGAAGG - Intergenic
1149240690 17:54645192-54645214 TGGGGTGGGGAGCAGAGGGAGGG + Intergenic
1151656200 17:75497207-75497229 TGGGGTGTGGGGAAGATACATGG - Intronic
1151715802 17:75830484-75830506 TGGGGTGGGGAGCAGGGGCAGGG + Intronic
1153269770 18:3308523-3308545 TGGGGAGTGGAGACGAGGCTGGG - Intergenic
1153890088 18:9505357-9505379 TAGGGTGTGGAGAAGAGGCAGGG - Intronic
1154101926 18:11483737-11483759 TAGAGTGGGGAGAAGTGGGAAGG + Intergenic
1155438881 18:25841081-25841103 TCAGTTGTGGAGAAGAGGCTAGG - Intergenic
1155932050 18:31718680-31718702 TCAGGAGTGGAGAGGAGGCAGGG - Intergenic
1156267432 18:35501325-35501347 TATGGTGTGGAGTGGAGGAAGGG - Intergenic
1156330514 18:36117315-36117337 TTCAGTGTGCAGAAGAGGCATGG - Intronic
1156411014 18:36828635-36828657 GAGGGTGTGGAGGAGAAGGAAGG - Intronic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1156967607 18:43114261-43114283 TAGGGTGAGGAGAAGAGGTAGGG + Intronic
1157394012 18:47326840-47326862 GAAGGTGTTGAGGAGAGGCAGGG + Intergenic
1157454208 18:47811590-47811612 TGGGGTCTGGAGGAGATGCATGG - Exonic
1158382702 18:56951378-56951400 GAGGGTGTGAGGAAGAGGTACGG - Intronic
1158670378 18:59468815-59468837 TTAGGTGTGGAGAAAAGGCCAGG + Intronic
1158850518 18:61491955-61491977 GAGTGTGTGGAGAAGAGGCTAGG - Intronic
1158959443 18:62576626-62576648 TGGGGTGTGGAGGGGAGGAAAGG + Exonic
1160409553 18:78666669-78666691 TGGGGTGTGCAGGAGAGGAAGGG + Intergenic
1161255499 19:3306810-3306832 GAGGGGGTGGAGAGGAGGCGGGG - Intergenic
1161716730 19:5880518-5880540 TGGGGGGTGGGGAAGGGGCAGGG - Intronic
1161821449 19:6533299-6533321 GAGGGTTTGGGGAAGGGGCAGGG - Intronic
1162882100 19:13667374-13667396 TAGGCTATGGAGAAAAGGGAGGG - Intergenic
1163095918 19:15056954-15056976 CAGGTTGTGGAAAAGAGGCTGGG - Exonic
1163732282 19:18955993-18956015 TGGGGTGAGGAGAACAGGAAGGG + Intergenic
1163919833 19:20278036-20278058 TAGATTGTGAAGAAGAGGCAGGG + Intergenic
1164352905 19:27374739-27374761 TGGGGTGTGGTGAGGAGGGAGGG - Intergenic
1164901464 19:31929545-31929567 TAGGGTGTGGAGAACAGGCCTGG - Intergenic
1165144896 19:33724700-33724722 TAGGATGGGGAGAAAAGGGAAGG - Intronic
1165158548 19:33802619-33802641 TGGGGTGGGGACAAGAGCCACGG + Intronic
1165607053 19:37114708-37114730 TAGATTGTGAAGAAGAGGCAGGG - Intronic
1165844991 19:38812514-38812536 CAGCGTCTGGAGAAGAGGCCTGG + Exonic
1166815425 19:45541923-45541945 TAGGGTGTGGAGTAGGTCCACGG + Intronic
1166980912 19:46631598-46631620 TAGGGTGTGGAGGAGGAGCGGGG - Intergenic
1167478079 19:49712476-49712498 TGGGGTGGGGATAAGAGGAAAGG + Intronic
1167619581 19:50553295-50553317 AAGGCTGTGGAGCAGAGGCGGGG - Intronic
1167916977 19:52749002-52749024 TAGATTGTGAAGAAGAGACAGGG - Intergenic
1168529169 19:57113532-57113554 TAGAGTGGGGAGAAGAACCATGG - Intergenic
1168679667 19:58305451-58305473 TGGTGTGTGGAGGAGAGGCGAGG + Intronic
1202692399 1_KI270712v1_random:101223-101245 CAGGGTCAGGACAAGAGGCAGGG + Intergenic
925610134 2:5695909-5695931 ATGGGTGGGGAGAAGAGGCAGGG - Exonic
925739391 2:6992489-6992511 TAGGGTGTGGAGAACGGGTAAGG + Intronic
925981663 2:9182050-9182072 TTGGATGTGGAGCAGAGGGAAGG + Intergenic
926615392 2:14992001-14992023 TAGTGTGTGGAGATCAGGGAAGG + Intergenic
926983331 2:18594774-18594796 AAGGCTGTGGAGAAGGGGAAAGG + Intergenic
927239213 2:20905594-20905616 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
927270819 2:21208714-21208736 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
928087743 2:28356364-28356386 TTGGAGGTGGGGAAGAGGCACGG - Intergenic
928983089 2:37156378-37156400 TGAGGTGTGGAGAAGAGGTAGGG + Intronic
929716882 2:44321099-44321121 AAGGATGTGGAGTAGAGGGAAGG - Exonic
929939502 2:46322219-46322241 TAGCGGGTGGAGAAGAGGAGGGG - Intronic
930053238 2:47233273-47233295 TGTTGTGTGGAGAACAGGCATGG - Intergenic
931029435 2:58155711-58155733 AAGGGTGGGGTGAAGAGGGAGGG - Intronic
931954503 2:67405233-67405255 CAGGGTGTGGAGAAAAAGAAAGG + Exonic
932371529 2:71193064-71193086 GAGGTTGTGGAGAAAAGGGAAGG - Intronic
932599222 2:73112584-73112606 TCGGTGGTGGAGAAGACGCACGG - Exonic
932684554 2:73857195-73857217 TAGGGTATGGAGAGGACCCAGGG - Intronic
932980208 2:76654313-76654335 TAGGGGCTGAAGAAGAGGCAGGG - Intergenic
933328185 2:80864552-80864574 GAGGAAGAGGAGAAGAGGCAGGG - Intergenic
933529974 2:83496480-83496502 TAGGGTGTGGAGAGGTGGGAGGG - Intergenic
933953996 2:87352748-87352770 CAGGGTCAGGACAAGAGGCAGGG - Intergenic
934238201 2:90248991-90249013 CAGGGTCAGGACAAGAGGCAGGG - Intergenic
934322320 2:91981518-91981540 CAGGGTCAGGACAAGAGGCAGGG - Intergenic
935070918 2:99692685-99692707 TAGGGTTCAGAGAAGAGGGAAGG - Intronic
935807109 2:106760105-106760127 TGGGAGGTGGAGAAGAGGCTTGG + Intergenic
935836626 2:107062212-107062234 GAATGTGTGCAGAAGAGGCAAGG + Intergenic
935931844 2:108135000-108135022 AATGGTGTGGATAAAAGGCATGG - Intergenic
936002605 2:108849423-108849445 CAGGGTGTGGAGGAAAGGGATGG - Intronic
936516773 2:113185944-113185966 TAGGCTCTGGAGAAGAAGCTGGG - Exonic
937494059 2:122399513-122399535 TAAGATGTAGAGAAGAGGAAAGG - Intergenic
937670582 2:124533517-124533539 GTGGGTGTGGAGGAGAGGGATGG + Intronic
938149607 2:128870797-128870819 GAGGATGAGGAGAAGAGTCATGG + Intergenic
938594701 2:132776323-132776345 AAGGAGGTGGAGAAGGGGCACGG - Intronic
939085638 2:137715785-137715807 GGAGGTGTGGAGGAGAGGCATGG + Intergenic
939650635 2:144757876-144757898 CAGGGTGTGGGGAAGAAGGAGGG - Intergenic
940910239 2:159203906-159203928 AATGGTGTGGACAAGAGACAGGG - Intronic
941071206 2:160956495-160956517 CAGGGGGTGGAGCAGGGGCAGGG - Intergenic
942525588 2:176849469-176849491 GAGAGTGTGGAGGTGAGGCAGGG - Intergenic
942553953 2:177151911-177151933 AAGGCTGTGGGGAAGAGGCATGG - Intergenic
943129091 2:183835478-183835500 TAGGGGGTTGAGAAGATGCTGGG - Intergenic
943273730 2:185841869-185841891 TGGGGTGTGGGGAGGGGGCAGGG - Intergenic
943892733 2:193311057-193311079 TTTGGAGTGCAGAAGAGGCAGGG + Intergenic
944175212 2:196821198-196821220 TAGGGTGTCCAGAGGTGGCATGG + Intergenic
944223727 2:197328319-197328341 TAGGGTCTGGAGTGGAGGTAGGG - Intergenic
945401590 2:209388928-209388950 TAGGGTGAAGAGTGGAGGCAGGG + Intergenic
946095507 2:217270818-217270840 TTGGGTGTGGAAAGGAGGCCAGG + Intergenic
946193900 2:218022077-218022099 CTGGGTGTTGAGAAGAGGCCAGG - Intergenic
946401873 2:219472506-219472528 CTGGGTGAGGAGAGGAGGCACGG + Intronic
946938312 2:224744672-224744694 TGGGGTGGGGGGAAGAGGGAGGG - Intergenic
947522933 2:230862407-230862429 CAGGGTGTGGACAAGTGACAGGG - Intergenic
948646004 2:239405497-239405519 TGGGGTGGGGAGAGGAGGGAGGG - Intergenic
948678707 2:239615673-239615695 TAAAGTGTGAAGAATAGGCAAGG - Intergenic
1168897883 20:1336490-1336512 TCAGGTGCGGTGAAGAGGCAAGG - Intronic
1168909819 20:1438803-1438825 TTTGGTGTGGGAAAGAGGCAAGG + Intergenic
1169194055 20:3673979-3674001 TGGGGTTTGGGGAAGAGGAAGGG - Intronic
1169195595 20:3680727-3680749 AAGGGTTTGGGGAAGAGGTAGGG + Intronic
1169903492 20:10576351-10576373 CAGGGAGTTGAGTAGAGGCATGG + Intronic
1170591536 20:17775535-17775557 TGAGGTGTGGAAAAGAGGAAGGG - Intergenic
1170791230 20:19511147-19511169 CAGGGTGGAGAGATGAGGCAGGG - Intronic
1171878142 20:30597554-30597576 GAGGGTGTGGACATGGGGCATGG - Intergenic
1172134526 20:32678072-32678094 AAGGGTGTGGAGGGGAGGCAGGG - Intergenic
1172230491 20:33332816-33332838 TAGGGTGTGGAGGGGACACAAGG + Intergenic
1172337436 20:34129000-34129022 TAGATTGTGAGGAAGAGGCAGGG + Intergenic
1172645302 20:36465452-36465474 CGGGCTGTGGAGAAGAGGCCTGG - Intronic
1173359138 20:42324302-42324324 TAAGTTATGGAGAAAAGGCAAGG + Intronic
1174082472 20:47980291-47980313 AAGGGTGTGGAAACTAGGCAGGG + Intergenic
1175315525 20:58044170-58044192 GAGGGTGTGCAGCAGAGGGAGGG + Intergenic
1177571633 21:22894741-22894763 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1178503561 21:33145365-33145387 TGGGGAGGGGAGAAGAGGCGAGG - Intergenic
1178776904 21:35560376-35560398 TTGGCTGTTGAGCAGAGGCAAGG - Intronic
1179144939 21:38759767-38759789 GAGGCTGTGGAGACCAGGCAGGG + Intergenic
1179179871 21:39036072-39036094 TACGGTGGGGACAGGAGGCATGG - Intergenic
1179264636 21:39792379-39792401 TAGGGTGGGGGGAAGGGGGAAGG + Intronic
1179402534 21:41097182-41097204 AAGGGTGAGGAGAAGAGCAAAGG + Intergenic
1179480124 21:41671683-41671705 GGGGGTTTGGAGAGGAGGCAGGG + Intergenic
1179546800 21:42118083-42118105 TAGGAAGTGGTGAAGAGCCAGGG - Intronic
1180800098 22:18627693-18627715 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1180847888 22:18994346-18994368 TAGAGAAGGGAGAAGAGGCAGGG - Intergenic
1180851331 22:19023258-19023280 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG + Intergenic
1181527890 22:23500517-23500539 AAGGGAGGGGAGAAGAGGAAGGG + Intergenic
1181531734 22:23521129-23521151 TGGGCTGTGGGGAAGGGGCAAGG - Intergenic
1181534350 22:23533995-23534017 GAGGGTGGGGAGATGAGGAAGGG + Intergenic
1181535308 22:23539199-23539221 CAGATTGTGAAGAAGAGGCAGGG + Intergenic
1182148404 22:28011742-28011764 GAAGGTAAGGAGAAGAGGCAAGG + Intronic
1182655213 22:31884627-31884649 TAGGGTATGGAGATGAGGGCAGG - Intronic
1183009427 22:34932573-34932595 AAAGGTGTGGAGTAGAAGCAGGG + Intergenic
1183470457 22:38003139-38003161 TAGGATGTGGAGAACAGGGGAGG + Intronic
1183676333 22:39300802-39300824 GAGGGTGTGCAGCAGAGGCAGGG + Intergenic
1183829737 22:40411436-40411458 AAGTCTGTGGAGAAGAGGCTGGG + Exonic
1184057586 22:42062800-42062822 TAGGGTGTGGAGGGAAGGAAGGG - Intronic
1184344975 22:43907616-43907638 CAGAATGTGGAGAAGATGCAGGG + Intergenic
1184422826 22:44391735-44391757 CAGGGAGTGGAGGAGAGGAAGGG - Intergenic
1184703427 22:46193725-46193747 TAGGGTGTTGGGAAAAGGTAGGG - Intronic
1185185380 22:49396119-49396141 TGGGGTGAGGAGGAGAGGTAAGG + Intergenic
1185329949 22:50248001-50248023 GAGGGTGCGGGGCAGAGGCACGG + Exonic
949684151 3:6549172-6549194 TATGATATGGACAAGAGGCAGGG + Intergenic
949911166 3:8909195-8909217 TAAGGGGAGGAGAAGAGGCAAGG + Intronic
950057187 3:10034795-10034817 CCAGGTGTGGAGAGGAGGCATGG + Exonic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
950405471 3:12801643-12801665 TAGGGTGGGCACCAGAGGCAAGG - Intronic
950548688 3:13653849-13653871 GAGGGTGTGGAGAAGAGAGGAGG - Intergenic
950581351 3:13864330-13864352 TAGGGAGGGTAGAAGAGGCTGGG - Intronic
951365517 3:21777333-21777355 GAGGATGTGGAGTAGAGGAAAGG - Intronic
951551137 3:23876201-23876223 TAAGGTGAGGGGAAGAGGAAAGG - Intronic
952763217 3:36933893-36933915 TAGGCTGTGAGGATGAGGCATGG + Intronic
953225303 3:41013499-41013521 TAGAGTGGGGAAATGAGGCAGGG + Intergenic
953927198 3:46988509-46988531 GAGGGTGTGGAGAAGGGGAGTGG - Intronic
954250189 3:49361451-49361473 TTGGGAGTGGAGGAGAGGGAAGG + Intronic
954411948 3:50374682-50374704 CAGGGTGCGGGGCAGAGGCAGGG + Intronic
954437541 3:50503889-50503911 TGGGGTGGGGAGGAGCGGCAGGG - Intronic
954898075 3:53994518-53994540 TAATGTGAGGAGAAGGGGCATGG + Intergenic
954953048 3:54491869-54491891 TAGGTGGTGGAGGAGAGGCTGGG + Intronic
957644330 3:82901571-82901593 TGGGGTGGGGGGAAGGGGCAGGG - Intergenic
958758712 3:98281174-98281196 GAGGCTGTGGAGAAAAGGAAAGG + Intergenic
959182532 3:102999997-103000019 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
959935775 3:112026863-112026885 TAGGGTGGGGTGAAAAAGCATGG + Intergenic
960134618 3:114092653-114092675 TAGTGTGCGGAAAGGAGGCACGG - Intergenic
960571762 3:119191596-119191618 TGGGGTGTGGAGTAGGAGCAGGG - Intronic
961154423 3:124666646-124666668 AATGGTGATGAGAAGAGGCAAGG + Intronic
961439617 3:126945109-126945131 AAGGCTGGGGAGAAGAGGCCAGG + Intronic
961682253 3:128607302-128607324 TAGGGAGTGTAGCACAGGCATGG + Intergenic
962466871 3:135668774-135668796 TAGGGTGTGGGGACGGGGGAGGG - Intergenic
962824856 3:139091459-139091481 GAGGGTGTTGGGAAGAAGCAAGG - Intronic
963323553 3:143836040-143836062 TAGGCTGTGGAGAGAAGTCAGGG - Intronic
963368277 3:144366401-144366423 AAGGGTGGAGGGAAGAGGCAGGG + Intergenic
963394444 3:144714597-144714619 TATGTTGTGGAGAAGACCCAGGG - Intergenic
963867055 3:150372912-150372934 TGTGGGGTGGAGAAGATGCAAGG + Intergenic
964628370 3:158781334-158781356 TGGAGTATGGAGAAGAGCCAGGG - Intronic
965434415 3:168631089-168631111 TAGGGTGCAGAGAAAAGGGAAGG - Intergenic
966028008 3:175309624-175309646 TAGGGTGGGGAGTAGTGTCAGGG - Intronic
966303061 3:178500173-178500195 TAGAATGTGGGGAAGAGGCCAGG - Intronic
966540625 3:181086128-181086150 AGGGGTGTGGTGACGAGGCAAGG - Intergenic
966691273 3:182744158-182744180 TGGGTTGTGGAGAAGTAGCAAGG - Intergenic
966880064 3:184345122-184345144 AAGTGTTTGGAGAGGAGGCAGGG + Exonic
967494158 3:190124036-190124058 TAGGGTTTGGAGAATAGGTAGGG + Intergenic
967739785 3:192992408-192992430 TAGGATGTGGTAAAGAAGCAAGG + Intergenic
968619448 4:1597264-1597286 TGGGGGGAGGAGCAGAGGCAGGG - Intergenic
969378014 4:6775915-6775937 GAGGGTGTGCAGCAGAGGCTTGG + Intergenic
969521729 4:7681951-7681973 TAGTGTGGTGTGAAGAGGCACGG - Intronic
969713240 4:8856462-8856484 TAGGAGGAGGAGAAGAGGCCGGG + Intronic
969982104 4:11168312-11168334 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
970146059 4:13037249-13037271 TAGGTTGTGGAGAAAAAGGAAGG + Intergenic
970169410 4:13274856-13274878 TAGAGTGTGAGGAAGAGGCAAGG - Intergenic
970983548 4:22129145-22129167 TAGGGTGGGGAGAGGGGGGAGGG + Intergenic
970998950 4:22301023-22301045 GTGGAGGTGGAGAAGAGGCAAGG - Intergenic
971296031 4:25392875-25392897 AAGGATGTGGAGTAGAGACAAGG - Intronic
971481400 4:27117961-27117983 TGGGGTGGGGAGAGGAGGGAGGG - Intergenic
971523164 4:27581237-27581259 TGGGGGGTGGTGAAGAGGTAAGG - Intergenic
971567144 4:28159767-28159789 TAGGGTGGGGGGAGGAGGGAGGG + Intergenic
972675155 4:41253062-41253084 TATGATGTGGAGAAGAGAAAGGG - Intergenic
972871263 4:43301843-43301865 GTGGGTGTGGAGAAAAGGGAAGG - Intergenic
973065935 4:45792853-45792875 TAGTGGGTGGAGAACAAGCATGG + Intergenic
974000739 4:56508281-56508303 AAGGGAATGGAGAAGAGGCAGGG + Intronic
974056480 4:56988162-56988184 CAGGGTTTGGAGAAGGGGCCGGG + Intronic
974139771 4:57870718-57870740 TTGGGTCAGGAGAAGAGACAAGG - Intergenic
974349766 4:60730149-60730171 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
974439479 4:61898249-61898271 AAGGGAGTGGAGAAAAGCCAAGG - Intronic
975188254 4:71428740-71428762 TAGCATGTGGACATGAGGCAGGG + Intronic
977081949 4:92541143-92541165 TAGGGTGGGGAGAGGGGGGAGGG + Intronic
977091447 4:92681540-92681562 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
977363381 4:96034782-96034804 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
977478520 4:97542974-97542996 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
977770892 4:100858247-100858269 CAGGGGGTGGAGGAGAGACAGGG + Intronic
978744736 4:112179558-112179580 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
979130390 4:117037583-117037605 TAGGAAGTGGAGATGAGGAAGGG - Intergenic
979423065 4:120530528-120530550 TGGGGTGTGGGGAGGGGGCAGGG - Intergenic
979684633 4:123497797-123497819 TAGGGTGGGGAGAGGTGGAATGG - Intergenic
980122825 4:128745272-128745294 TCGGGGCTGGGGAAGAGGCAAGG - Intergenic
980556246 4:134409461-134409483 TAGAGTGTGGATAAATGGCATGG - Intergenic
981107876 4:140901946-140901968 ATGGGAGTGGGGAAGAGGCAGGG + Intronic
982410354 4:155069086-155069108 TGGGGTGGAGAGAAGAGGGAGGG + Intergenic
984608309 4:181809863-181809885 TCTGGAATGGAGAAGAGGCAGGG + Intergenic
985202738 4:187501434-187501456 GAGGGGATGGAGAAGAGGGACGG - Intergenic
985631850 5:1017986-1018008 CAGTGTGTGGTGAGGAGGCATGG + Intronic
986658096 5:10034994-10035016 GAGGGTGCGGAGAGGATGCATGG - Intergenic
986735757 5:10666195-10666217 TGAGGTGTGGCGAAGAGGCCTGG + Intergenic
986827042 5:11533061-11533083 CAGGGGGCGGAGAAGAGGAAAGG + Intronic
987041254 5:14064915-14064937 TCAGGGGTGGAGAAGAGACAGGG - Intergenic
987115882 5:14726398-14726420 TTGTGGGTGGAGGAGAGGCAGGG + Intronic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
988667717 5:33348307-33348329 TAGGGTGGGGGGAAGGGGAAGGG - Intergenic
989238773 5:39179834-39179856 TAGGTTGAGGAGAGGAGGTAGGG - Intronic
989426649 5:41303661-41303683 TAGGTAGTGGAAAAGAGGGAGGG + Intergenic
989558537 5:42825249-42825271 TATGATATGGACAAGAGGCAGGG + Intronic
989613088 5:43313618-43313640 AAGGGCGGGGAGAAGAGGCGGGG + Intergenic
990643164 5:57811036-57811058 TAGGGTGGGGAGAGGGGGGAGGG + Intergenic
991047044 5:62233472-62233494 TAGGGTGTTGAGAATAAACAGGG - Intergenic
991262204 5:64679241-64679263 CAGGATGTGTCGAAGAGGCATGG - Intergenic
991650453 5:68847294-68847316 TAGCTTGTGGAGAAGAGACTGGG + Intergenic
991941578 5:71858120-71858142 CAGGATGTGGAGCAGGGGCAGGG - Intergenic
992190846 5:74290319-74290341 TTGTGTGGTGAGAAGAGGCAGGG - Intergenic
992738002 5:79743043-79743065 GGGGCTGTGGAGAAGAGGTAAGG + Intronic
993240622 5:85379991-85380013 TGGGGTGGGGGGAAGAGGGAGGG - Intergenic
997198373 5:131994647-131994669 TGGGGTGTGGAGAAGAGGGAAGG + Intronic
997226853 5:132215369-132215391 TAGGGTGTGGAGAACAAGATTGG + Intronic
997351895 5:133236815-133236837 CAGGGTGTGGGGAAGAGGTTAGG - Intronic
997722259 5:136088601-136088623 TTGGGTGGGGAGAAGAGGAAGGG + Intergenic
998454864 5:142264082-142264104 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
998478537 5:142441988-142442010 AAGGATGTGGAGAGGAGGCAGGG + Intergenic
999453971 5:151699398-151699420 GAGGGTGTGGGGACGTGGCAGGG - Intergenic
999866165 5:155702490-155702512 TTGGGTCTGGAGACTAGGCAAGG + Intergenic
1000203113 5:159031219-159031241 TGGGATGTGGAGAAGAGGTCAGG + Intronic
1001093771 5:168760749-168760771 GAGGGAGTGGAGCAGAGGCTGGG + Intronic
1001240716 5:170067875-170067897 CAGGGTATGGAAAAGAGGCTGGG - Intronic
1001402651 5:171454908-171454930 CAGGGGGTGGTGAGGAGGCAGGG - Intronic
1001875207 5:175194426-175194448 TATGGCTTGTAGAAGAGGCAGGG + Intergenic
1001887268 5:175304293-175304315 TAGGCTTCGGAGAAGAAGCAGGG + Intergenic
1002860430 6:1075011-1075033 GAGGGTTTGCAGAAGAGGCCTGG - Intergenic
1003060496 6:2858778-2858800 TTGGGTGTGGGGAAGAGGTAGGG - Intergenic
1003172081 6:3727767-3727789 TACGGTGTGGAAGAGAGGCACGG - Intronic
1003458061 6:6302175-6302197 TAGGGTGGGGAGAAGAGGAGAGG - Intronic
1005021223 6:21420868-21420890 TAGGGTGAGGAGAGGAGGGAAGG + Intergenic
1005383988 6:25267704-25267726 TAGGGTGAGGAGGAAAGGGAGGG + Intergenic
1005666430 6:28062291-28062313 TAGGGTGTCCAGAGGAGGGAGGG + Intergenic
1005789265 6:29279437-29279459 TGGGGTGTGGTGAGGGGGCAGGG + Intergenic
1005933548 6:30501135-30501157 TAGGGTCTGGACAAGGGGAAGGG + Intergenic
1006436763 6:34029757-34029779 GAAGGTGAGGAGAAGAGACATGG + Intronic
1006863042 6:37186358-37186380 GAGGATGTGGAGAAAAGGGAAGG - Intergenic
1007257940 6:40541637-40541659 TGGGGTGTGGAGCAGAGCCCAGG + Intronic
1007386505 6:41523690-41523712 TAGGGTCTGGGGATGATGCAGGG - Intergenic
1007714791 6:43849482-43849504 CAGGGAGAGGAGAAGAAGCAGGG + Intergenic
1008626797 6:53325075-53325097 TAGGGTGTTGGGCAGAGTCAGGG - Intronic
1008817493 6:55586535-55586557 TAGGGTGGGGGGAGGAGGGAGGG - Intergenic
1011000139 6:82579090-82579112 TAATGGGTGGAGAAGAGGCAGGG + Intergenic
1011389677 6:86838195-86838217 TTTGGGGTGCAGAAGAGGCAGGG + Intergenic
1012013391 6:93822633-93822655 TAGATTGTGTAGAATAGGCAGGG - Intergenic
1012242411 6:96888540-96888562 TAGGGTGAGGAGAGGAAGGAAGG - Intergenic
1013477541 6:110522710-110522732 TATGGTGTTGAGAATAGCCATGG - Intergenic
1014082457 6:117303445-117303467 TAGGGTGTGGATGGGAGTCAGGG + Intronic
1016066581 6:139689099-139689121 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1016154269 6:140784175-140784197 CAGGGGGTGGAGAAGGAGCATGG + Intergenic
1016163378 6:140908470-140908492 TAGAGGGGGGAGAAGTGGCAGGG + Intergenic
1016177442 6:141097974-141097996 TGGGGTGTGGGGAGGAGGCAGGG - Intergenic
1016260488 6:142163689-142163711 GGGGGTGTGGGGAAGAGGCATGG + Intronic
1017629394 6:156381669-156381691 GAAAGTGGGGAGAAGAGGCAAGG - Intergenic
1018008111 6:159642160-159642182 CATGGTGTGGAGTAAAGGCATGG + Intergenic
1018617533 6:165702280-165702302 AAGGAAATGGAGAAGAGGCAGGG - Intronic
1019341265 7:510180-510202 TAGGGCGTGGAAAGGAGGCCAGG + Intronic
1019616170 7:1963414-1963436 TGGGGTGGGGAGAGGAGGCAGGG + Intronic
1019767474 7:2862525-2862547 TAACGTATGGAGAACAGGCAGGG + Intergenic
1021210422 7:17845105-17845127 GAGGGAGGGGAGAAGAGGTAAGG + Intronic
1021292267 7:18860883-18860905 AAGGGTGTGGAGAGCGGGCAAGG - Intronic
1021344160 7:19502947-19502969 TAGAGTGAAGAGAAGAGGAAAGG + Intergenic
1021539011 7:21736362-21736384 TAGGGTGAGCAAAAGAGACATGG + Intronic
1022051080 7:26672941-26672963 TTGGGGGTGGAAAAGAGGAAAGG - Intronic
1022503319 7:30895936-30895958 TGGGGTGTGGGGCAGAGGCTGGG + Intergenic
1022562634 7:31365559-31365581 AAGGGTGTCGGGAGGAGGCACGG - Intergenic
1023828264 7:44024285-44024307 TGGGGAGGGGAGGAGAGGCATGG + Intergenic
1023829601 7:44031068-44031090 GAGGGTGGGGAGCCGAGGCAGGG - Intergenic
1024574761 7:50754701-50754723 AAGGGTGTGGATATGAGGGAAGG + Intronic
1024695995 7:51857257-51857279 GAGGGTGTTGGGCAGAGGCAGGG + Intergenic
1026015852 7:66669995-66670017 TTGGGGGTAGAGAGGAGGCAGGG - Intronic
1026153707 7:67809633-67809655 TTGGGTGTGGTGATGAGGAAAGG - Intergenic
1026818750 7:73532396-73532418 TAGGGTCTGGAGAAGAATCTTGG - Intergenic
1026892477 7:73990374-73990396 GAGGGGGTAGAGAGGAGGCAGGG - Intergenic
1027275356 7:76549929-76549951 TAGAGTGTGGGGCAGAGGGAGGG + Intergenic
1027654021 7:80905911-80905933 TAGGCTCTGGAAAAGAGTCATGG + Intronic
1027730101 7:81860570-81860592 GAGGATGTGGAGAATAGGGACGG + Intergenic
1027823978 7:83087068-83087090 TAGGGTGGGGGGAAGGGGGAGGG + Intronic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1029118823 7:98252577-98252599 TGGGGCGTGGAGAGGACGCAGGG + Intronic
1029336305 7:99902739-99902761 TAAGGTGTGGAGAACATGGAGGG - Intronic
1029435425 7:100561659-100561681 TTGGCTCTGAAGAAGAGGCAGGG + Intronic
1029459349 7:100686330-100686352 GAGGGTGTGGTGAAGAGGAGGGG - Exonic
1029679192 7:102096276-102096298 AAGGGTGTTCAGAAGAGTCAGGG - Intronic
1029721067 7:102364479-102364501 TAGAGTGTGGGGCAGAGGGAGGG + Intronic
1029739909 7:102485326-102485348 GAGGGTGGGGAGCCGAGGCAGGG - Intronic
1029756565 7:102577731-102577753 TGGGGAGGGGAGGAGAGGCATGG + Intronic
1029757908 7:102584505-102584527 GAGGGTGGGGAGCCGAGGCAGGG - Intronic
1029774507 7:102676800-102676822 TGGGGAGGGGAGGAGAGGCATGG + Intergenic
1029775844 7:102683566-102683588 GAGGGTGGGGAGCCGAGGCAGGG - Intergenic
1030708122 7:112716410-112716432 TAGGGTGTGGGGAGGGGGAAGGG - Intergenic
1031179256 7:118393974-118393996 TGGGGTGTGGGGAGGAGGGAGGG + Intergenic
1031598160 7:123671486-123671508 GAGAGTGTGGAGAAGAGCAAAGG - Intergenic
1031929287 7:127668248-127668270 TAGAGTGGGGAACAGAGGCAGGG - Intronic
1032679932 7:134171867-134171889 TAGGTTGTGCAGGAGAGGGAGGG + Intronic
1033631260 7:143160354-143160376 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1033633132 7:143181155-143181177 TGGGGTGTGGGGAGGGGGCAGGG + Intergenic
1033914650 7:146308827-146308849 TAGGGTGGGGAGACGGGGGAGGG + Intronic
1033989921 7:147270933-147270955 TAGGGGGAAGAGAAGAGTCATGG - Intronic
1033990909 7:147285713-147285735 TGGGACATGGAGAAGAGGCAAGG + Intronic
1034360487 7:150492495-150492517 TAGGGTGGGGGGAAGGGGGAGGG + Intergenic
1034396061 7:150825759-150825781 TAGGTAGGTGAGAAGAGGCAAGG - Intronic
1034471692 7:151258087-151258109 TAGGGTGTGAGGGAAAGGCAGGG - Intronic
1034588508 7:152118096-152118118 TAGGGTAGAGAGAAGAGGAAGGG - Intronic
1034867664 7:154656069-154656091 AAGGGTGTGGAGGAGAGGAGCGG + Intronic
1035092870 7:156329183-156329205 GAGGGTGTGGAGAAGGGTCTGGG - Intergenic
1035446086 7:158944173-158944195 TTGGCTGTGGGGAACAGGCAGGG + Intronic
1035895378 8:3393839-3393861 TGGGGTGTGGGGAGGGGGCAGGG + Intronic
1036051133 8:5198918-5198940 TAAAGTCTGGAGAAGAGGCTTGG - Intergenic
1037021289 8:13974760-13974782 TAGGGTGGGGAGAAGAAACCTGG + Intergenic
1037617627 8:20533898-20533920 GAGGGAGTGAAGAAGAGCCATGG + Intergenic
1037627023 8:20617241-20617263 TAGAGTGTAAAGAAGAGGCATGG - Intergenic
1037950315 8:23015195-23015217 TAGTGTGTGGAGTGGAAGCACGG + Intronic
1038647531 8:29373800-29373822 CAGGGTCTGGAGTGGAGGCAGGG - Intergenic
1038970030 8:32622830-32622852 TAGTGTGTGGAAAAGTGACATGG + Intronic
1040832246 8:51690311-51690333 TAGGGTGTGGGGAAGGGGGAGGG - Intronic
1041233395 8:55775297-55775319 TAGGGTGTGCACAGTAGGCAGGG + Intronic
1042557319 8:70044400-70044422 TAGGGGGTGGGGGAGGGGCAGGG - Intergenic
1043046494 8:75330071-75330093 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1043207776 8:77469032-77469054 TAGGGTGGGGGGAGGAGGGAGGG - Intergenic
1043617363 8:82143574-82143596 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1043654054 8:82639685-82639707 AAGGATGTGAAGTAGAGGCAGGG + Intergenic
1044755593 8:95458069-95458091 GTGGATGTGGAGAAGAGGAATGG + Intergenic
1045415554 8:101963266-101963288 TAGGTTCTGGAGCAGAGGTATGG - Intronic
1045474078 8:102538319-102538341 CAGGGTGTGGTGAGGAGGCGGGG + Intronic
1045969637 8:108065021-108065043 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
1046283567 8:112066452-112066474 TAGGGTGGGGGGAGGGGGCAGGG - Intergenic
1046367378 8:113253369-113253391 TGGGGTGGGGAGAGGAGGGAGGG - Intronic
1046414067 8:113887846-113887868 TATGATGTGGAGAGGAGGGAAGG - Intergenic
1046674477 8:117093474-117093496 TTTGGTGTGGAGTAGTGGCAGGG - Intronic
1047711199 8:127554189-127554211 TTGGATGGGGAGAAGATGCAAGG - Intergenic
1047780220 8:128105065-128105087 TTGGGTGTGGAGGAGCAGCATGG - Intergenic
1048365125 8:133731790-133731812 GAGGGTGTGCAGAGGAGGAAAGG + Intergenic
1049218888 8:141419971-141419993 CAGGGTGTGGAGGGCAGGCAGGG + Intronic
1049296328 8:141841836-141841858 GAGAGTGTGGAGAACAGGGAAGG - Intergenic
1049758874 8:144322902-144322924 TAGGCTGGGGAGATGAGCCAAGG - Intronic
1049978371 9:881796-881818 TTGGGGGTGGAGAAGAAGAAAGG - Intronic
1051903423 9:22067064-22067086 TGGGGTGGGGAGAGGAGGGAGGG + Intergenic
1052533428 9:29717728-29717750 AAGGATGTGGAGAAAAGGGAGGG - Intergenic
1052944156 9:34154176-34154198 TAGAGTGTGCAGAAGAGGAAAGG - Intergenic
1054351956 9:64025509-64025531 TAGGGGGAGGAAAGGAGGCAAGG - Intergenic
1055606610 9:77977231-77977253 TGGAGTGTGGAGAAGGGCCAGGG - Intronic
1055675392 9:78653926-78653948 TGGGGTGTGGAGAGGGGGGAGGG + Intergenic
1056084753 9:83135347-83135369 TGGGGTGGGGGGAAGAGGGAGGG + Intergenic
1056119502 9:83473226-83473248 CAGGGGGTTGGGAAGAGGCAAGG - Intronic
1056776627 9:89517780-89517802 GAGGTTGTGGAGAAAAGGAAAGG - Intergenic
1057266894 9:93623079-93623101 GAGGGTGTGGACATGGGGCATGG + Intronic
1057550161 9:96046525-96046547 TGAGGTGTGGGGAAGAGGCGCGG - Intergenic
1058185404 9:101848672-101848694 TACTGTGTGGAGACTAGGCATGG + Intergenic
1058473346 9:105303887-105303909 TAGGGTGAGGAGCAGAAGCATGG + Intronic
1059482934 9:114606139-114606161 GCGGCTGTGGAGAAGAGGCAAGG - Intergenic
1060269703 9:122131897-122131919 GAGGCTGGGGGGAAGAGGCATGG + Intergenic
1060419211 9:123455468-123455490 TAGGGCGTGGTGACTAGGCAAGG - Intronic
1061375094 9:130219537-130219559 GAGGGTGGGGAGCAGAGGCTGGG - Intronic
1061603630 9:131690588-131690610 TAGGATGTGGAGAACAGCCTGGG + Intronic
1062487677 9:136788320-136788342 TAGATTGTGAAGAAGAGGCAGGG - Intergenic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1186518497 X:10185383-10185405 TGTGGTGTGGAGGAGAGGGAGGG + Intronic
1186542995 X:10420095-10420117 TAGGCTGGGGAAGAGAGGCAGGG - Intergenic
1187635465 X:21223098-21223120 TGGGGTGTGGAGAGGGGGGAGGG + Intergenic
1188114734 X:26229200-26229222 TATGGGGTGGAGATGGGGCACGG - Intergenic
1188899867 X:35717596-35717618 GAGGATGTGGAGAAAAGGAAAGG - Intergenic
1190429685 X:50367277-50367299 AAGGGTGGGGTGAAGATGCAAGG + Exonic
1190654881 X:52602579-52602601 TGGGGTGGGGGGAAGAGGGAGGG + Intergenic
1192244129 X:69359104-69359126 TGAGGGGTGGAGAAGAGACAGGG - Intergenic
1192394678 X:70767472-70767494 GAGGGTGTGGAGAAAAGGGGTGG + Intronic
1192556777 X:72096300-72096322 TTGGGAGTGAGGAAGAGGCAAGG + Intergenic
1192873036 X:75203452-75203474 TAGGGTTTGAAGAGAAGGCAAGG + Intergenic
1193855096 X:86590962-86590984 TAGGGTGCGGGGAAGGGGGAAGG - Intronic
1194078620 X:89429946-89429968 GAGGTTGTGGAGAAAAGGGAAGG - Intergenic
1194998990 X:100623884-100623906 TGGGGTGTGGGGAAGGGGGAGGG - Intergenic
1195255110 X:103082457-103082479 TAGGGTAGTGACAAGAGGCAAGG - Intronic
1197226462 X:123960732-123960754 GAGGGTGTAAAGAAGAGGAAGGG + Exonic
1197334396 X:125194263-125194285 TAGGGTGTGAGGAAGAAGGAGGG - Intergenic
1198162756 X:134023911-134023933 TGGGGGGTGGAGAAAAGGAATGG - Intergenic
1198166986 X:134067488-134067510 TGGGGTGGGGGGAAGAGGGAGGG + Intergenic
1198219013 X:134582707-134582729 TTGGGTGAGGAGAAAAGGCAAGG + Intronic
1198417365 X:136434249-136434271 TGGAATGTGGAGAAGAGGAAAGG - Intergenic
1198448669 X:136744133-136744155 TTGTGTGTTGAGTAGAGGCAGGG - Intronic
1198612373 X:138416467-138416489 GAGGTTGTGGAGAAAAGGGAAGG - Intergenic
1199080736 X:143574332-143574354 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1199665763 X:150095310-150095332 CAGAGTCTGGAGAAGAGACAGGG + Intergenic
1199846574 X:151695905-151695927 TAGGGTTTGGAGAAGTGGTTTGG + Intronic
1199894478 X:152117583-152117605 TAGGGTGTGGGGATGGGGCTGGG + Intergenic
1199929354 X:152502947-152502969 TGGGGTGGGGGGAAGGGGCAGGG + Intergenic
1200143362 X:153913115-153913137 AAAGGTGTGGATAAGAGCCAAGG + Intronic
1200257272 X:154590118-154590140 TAGATTGTGAAGAAGAGGCGGGG + Intergenic
1200260498 X:154614284-154614306 TAGATTGTGAAGAAGAGGCGGGG - Intergenic
1200296179 X:154923093-154923115 TGAGGTGTAGAGAAGAGGCTGGG + Intronic
1200431228 Y:3085068-3085090 GAGGTTGTGGAGAAAAGGGAAGG - Intergenic
1201189805 Y:11436693-11436715 TAGGGTCAGGACAAGGGGCAGGG - Intergenic
1201250009 Y:12047574-12047596 TAGGGTGTGGGGAGCAGGTAGGG + Intergenic
1201952476 Y:19580647-19580669 TAGGGTGGGGAGAGGGGGGAGGG - Intergenic
1202594990 Y:26529378-26529400 TAGGGTGGGGAGATGGGGGAGGG - Intergenic