ID: 1153892214

View in Genome Browser
Species Human (GRCh38)
Location 18:9528184-9528206
Sequence TGTGTGGCTCTCAGCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153892214_1153892217 -4 Left 1153892214 18:9528184-9528206 CCTTCAGAGCTGAGAGCCACACA No data
Right 1153892217 18:9528203-9528225 CACACAGAAATATAGAGGTGTGG No data
1153892214_1153892215 -9 Left 1153892214 18:9528184-9528206 CCTTCAGAGCTGAGAGCCACACA No data
Right 1153892215 18:9528198-9528220 AGCCACACACAGAAATATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153892214 Original CRISPR TGTGTGGCTCTCAGCTCTGA AGG (reversed) Intronic