ID: 1153899303

View in Genome Browser
Species Human (GRCh38)
Location 18:9602034-9602056
Sequence ATTCAGTTCTATAGGTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153899303 Original CRISPR ATTCAGTTCTATAGGTAACA AGG (reversed) Intronic
902976970 1:20095817-20095839 ATTCAGTTCGATTGGTAAGTGGG - Intergenic
905593336 1:39184293-39184315 CCTCAGTTCTATAGCTAGCAGGG + Intronic
907722376 1:56983978-56984000 GCTCAGTTCTACAGGTAACGTGG + Intergenic
909328032 1:74377335-74377357 ATTCTGTGCCATAGGTACCATGG - Intronic
909644924 1:77906277-77906299 CTTCAGTTTTATATGTAAAATGG - Intronic
910991788 1:93064120-93064142 ATAAAGTTGTATAGGTAAAAAGG - Intergenic
911819159 1:102394207-102394229 ATTCAATACTATTTGTAACAGGG - Intergenic
913508647 1:119542415-119542437 ATTTAATTCTATATGTAACCAGG - Intergenic
920717622 1:208355564-208355586 ATTCAGGTCTACAGATCACAAGG - Intergenic
922883094 1:228997342-228997364 ATGAAGTGCTATAGGTAAAAAGG + Intergenic
924067199 1:240236193-240236215 ATTCAGTTCTATTGGTAGAAAGG + Intronic
1065120836 10:22529232-22529254 AGTCTGTTTTATAAGTAACAAGG + Intergenic
1065601383 10:27372531-27372553 TTTCATTTTTAGAGGTAACAGGG + Intergenic
1066415978 10:35222508-35222530 ATTGAGTTGTACAGGTAAAATGG - Intergenic
1069372067 10:67758696-67758718 ATTCAATTCTATAAATAACTGGG + Intergenic
1072080483 10:92025104-92025126 ATGTAGTTCTATAGTTAAAAAGG - Intronic
1080104850 11:28501209-28501231 ATTCAATTCTAAAGGTAGTAGGG - Intergenic
1082132599 11:48508154-48508176 ATTTAGCTCTATAGCTAACAAGG - Intergenic
1082244237 11:49903350-49903372 GTTTAGCTCTATAGCTAACAAGG + Intergenic
1083842362 11:65311785-65311807 TTACAGTTCTATAGGTTAGAAGG + Intergenic
1083928522 11:65824640-65824662 ACTCTGTTCTGTAGGTGACAGGG - Intronic
1088168946 11:106972925-106972947 AGTCAGTTTTATAAGTTACAAGG - Intronic
1089999896 11:122947615-122947637 ATTCTGTTTTACAGGCAACAGGG + Intronic
1092951404 12:13507039-13507061 ATTCAGTTTTACAGGCAAGAGGG - Intergenic
1093518024 12:20013985-20014007 AATCATTTATCTAGGTAACAGGG + Intergenic
1095268944 12:40193746-40193768 ATTCAAAATTATAGGTAACAAGG - Intergenic
1095279266 12:40331326-40331348 ACTCTGTTCTTTAGGTTACATGG + Intronic
1097590006 12:61562981-61563003 TGTCAGTTCTATGAGTAACATGG + Intergenic
1098094468 12:66939724-66939746 ATGGAGTTCTCTAGGTATCAAGG + Intergenic
1098570362 12:71981333-71981355 ACTTAGTTCTGTAGGCAACAGGG + Intronic
1098661567 12:73100988-73101010 ATTTGGTTCTATGGGCAACAGGG + Intergenic
1099210294 12:79778063-79778085 AATTATTTCTATAGGTAATATGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1107388584 13:39939868-39939890 GTTTAGTTCTATAGGTATTATGG - Intergenic
1108786973 13:53915839-53915861 AAGCAGATATATAGGTAACATGG + Intergenic
1109841110 13:67917668-67917690 ATTCTGTACTGTAGGTCACATGG + Intergenic
1110658539 13:78030045-78030067 GTTCAGTTCTCTGTGTAACAAGG + Intergenic
1112901662 13:104364500-104364522 TTTCAGTTGTACAGGTAAAATGG + Intergenic
1114489289 14:23087688-23087710 TTTTAGTTCTATAGGTAATGGGG - Intronic
1116430383 14:44839337-44839359 GATCATTTCTATAAGTAACATGG - Intergenic
1116476130 14:45341760-45341782 ATTCACATCTATGGATAACATGG - Intergenic
1116654337 14:47632223-47632245 ATTCATTTCTATAGGGAAAATGG - Intronic
1120897387 14:89545867-89545889 AGGCAGAGCTATAGGTAACAGGG - Intronic
1127563593 15:60164875-60164897 ATTCAGTCCTACAGATAACCAGG + Intergenic
1129054765 15:72811229-72811251 CCTCAGTTCTATGGGTAAGAAGG + Intergenic
1129073247 15:72969724-72969746 ATTAAGTACTATAAGTAACCTGG - Intergenic
1131891655 15:96978572-96978594 ATACAGTTCTATACATAAAATGG - Intergenic
1133144900 16:3777456-3777478 ATTCAGTTCTACAGGTAGTATGG - Intronic
1134151105 16:11805501-11805523 ACTCATTTCAGTAGGTAACATGG - Intergenic
1136066001 16:27759273-27759295 ATTCAGTGCTATAAACAACAAGG + Intronic
1136365921 16:29809304-29809326 AATGAGTTCTGTAGGTACCAAGG + Intronic
1138715609 16:59018331-59018353 ATTCAGCTGAATAGGTCACAGGG + Intergenic
1138873795 16:60925527-60925549 CTTCAGCTCAATGGGTAACATGG + Intergenic
1139326352 16:66155446-66155468 ATTCAGATCCATATGTAATAGGG - Intergenic
1139721581 16:68860290-68860312 ATTCAGTTCTATATCTCAAAGGG - Exonic
1143493798 17:7299087-7299109 TTTAAGTACTATAGATAACAAGG + Intergenic
1144433349 17:15216378-15216400 ATCAAGTTCCATAGGCAACACGG + Intergenic
1153899303 18:9602034-9602056 ATTCAGTTCTATAGGTAACAAGG - Intronic
1153907281 18:9673377-9673399 ATGCAGTTCTCTAGCTACCAGGG + Intergenic
1159203069 18:65213756-65213778 TATCAGTTCTAGAGGTAACAAGG + Intergenic
1160065539 18:75570790-75570812 ATTCATTTTTATGGGTAAGATGG - Intergenic
1168614958 19:57830152-57830174 ATGTAGTTCCCTAGGTAACAAGG - Intronic
925845757 2:8031822-8031844 CTTCAGTTCTGTAATTAACAGGG - Intergenic
927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG + Intergenic
932281116 2:70492664-70492686 ATTCAGTTCAATAATTAAAAGGG - Intronic
938675390 2:133628415-133628437 ATTCAGCAATATAGCTAACAAGG + Intergenic
938679535 2:133675321-133675343 ACTCAATTCTATAGGCAAGAAGG + Intergenic
939865823 2:147471349-147471371 GCTCAGTTACATAGGTAACATGG - Intergenic
941286204 2:163616078-163616100 ATCCAGTTATATAGGAAATATGG - Intronic
943863759 2:192901120-192901142 ATTCAGTTGTAGAAGAAACAAGG - Intergenic
945622477 2:212157955-212157977 TCTCAGTTGTATAGGCAACATGG - Intronic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
948300026 2:236898562-236898584 ATTCAGTTTTATAGGAAAATGGG + Intergenic
1168738643 20:168659-168681 ATTCAGTTCTGTGGTCAACATGG - Intergenic
1170016290 20:11785958-11785980 ATTCAGCTCTTTAGGTCAAAAGG - Intergenic
1170398167 20:15950650-15950672 ATTCAGATCTATAAGCAACACGG + Intronic
1176422873 21:6530568-6530590 ATACAGTTCTAGAGGTGGCATGG + Intergenic
1178037805 21:28604176-28604198 ATCCAGTTCTATATGAAGCAGGG - Intergenic
1179285051 21:39970051-39970073 CTTCAGTTCTATAGGAAAATTGG - Intergenic
1179698366 21:43138885-43138907 ATACAGTTCTAGAGGTGGCATGG + Intergenic
1182241308 22:28918402-28918424 ACTCAGCTCTATAGGTTACGAGG - Intronic
1182971538 22:34583810-34583832 ATTCATTTGCATAGGTATCAAGG - Intergenic
949655095 3:6208687-6208709 ATTCAGTTTTATAGTAAAGATGG - Intergenic
956654765 3:71538200-71538222 ATTCAGTTCTATTGTTTAAAAGG - Intronic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
957799311 3:85054449-85054471 ATTTAATTCCATAGGTGACAAGG + Intronic
960498064 3:118399783-118399805 ATTCATTTCTATACGTATCTGGG + Intergenic
962258619 3:133888584-133888606 ATTCTGATCTCTTGGTAACAAGG - Intronic
966464539 3:180215294-180215316 GTTCAGTTCTACACGAAACAAGG - Intergenic
966712739 3:182986120-182986142 ATCCAGTTCCACAGGTAGCAAGG + Intergenic
969208463 4:5667052-5667074 ATTCAGAACTATAGGGAAAAGGG - Intronic
973046360 4:45538236-45538258 ATTCAGTTATCTCAGTAACAGGG + Intergenic
976408842 4:84689555-84689577 ATTCAGTTTTATACTGAACAGGG + Intronic
976673780 4:87682421-87682443 ATTAAGTTCTTTAGGTTCCATGG - Intergenic
980999974 4:139819412-139819434 ATTTTGTTCCATAGGTAGCATGG + Intronic
981653423 4:147084944-147084966 ATTGAATTCTGTAGATAACAAGG - Intergenic
982092618 4:151893523-151893545 ATTCAGTTCTACAGGCAAAAAGG - Intergenic
984419657 4:179504439-179504461 ATTCAGTACCATATGTCACAGGG - Intergenic
984957072 4:185055483-185055505 ATTAAGTTCTAAAGGTGAAAAGG + Intergenic
987594439 5:19978626-19978648 ATTCCGTTCTAGAGGTACTAGGG + Intronic
989147897 5:38266574-38266596 ATTCTTTTCTATAGGTATTAAGG + Intronic
989849204 5:46187253-46187275 ATTGAGTTCTATAGTAAAAAAGG + Intergenic
990055312 5:51569718-51569740 ATTTAATTCTATAGGTATCTGGG + Intergenic
990778660 5:59333176-59333198 ATCCAGTTCTCTAGGTCAAAAGG + Intronic
992468952 5:77035677-77035699 TTTCTGTTCTATCGGTACCAGGG - Exonic
996042485 5:118831370-118831392 ATCCCGTTCAATAGGTCACATGG + Intergenic
996177440 5:120377396-120377418 ATTAAGTTATAAAGGTGACATGG + Intergenic
996228965 5:121037709-121037731 ATTCAGTTTTATCTGTAAAATGG - Intergenic
996486762 5:124044334-124044356 ATTCAGTTTAATAGGGAACAGGG + Intergenic
999066851 5:148696612-148696634 ATGCACTTCTGTAGGTAACGGGG + Intergenic
1001236956 5:170038220-170038242 ATGAAGTACTATAGGTAATATGG + Intronic
1004136867 6:12975906-12975928 AGCCAGTGCTATAGGTAAAATGG + Intronic
1005696752 6:28358937-28358959 TTCCAGTTCTATAGGTCAGAAGG + Intronic
1007042385 6:38734707-38734729 ATTCAGTCCTATATTTAAAAAGG - Intronic
1008791139 6:55235616-55235638 ATTTAGATCTATAAGTAACCTGG + Intronic
1009943343 6:70315492-70315514 ATTCTGTTCTATAGGCAGAAGGG + Intergenic
1012103109 6:95116678-95116700 ATTCATTTATATAAGTAATATGG + Intergenic
1012354834 6:98301058-98301080 ATTAAGTCCTGTGGGTAACATGG - Intergenic
1014242684 6:119035196-119035218 ATTCAGTTCTTTGGGGAACTTGG - Intronic
1014629767 6:123773962-123773984 ATTCTTTTCTATAGATGACATGG + Intergenic
1015338666 6:132071913-132071935 ACTCAGTTCTCTAGGTTCCAGGG + Intergenic
1022801430 7:33780707-33780729 ATTCAGTTCAGTAGGCACCAGGG - Intergenic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1025583845 7:62755935-62755957 ATTGAGTTCTATGGTTAAAAAGG + Intergenic
1026264291 7:68783024-68783046 TTTCGTTTCTATAGGGAACAAGG - Intergenic
1028486495 7:91363948-91363970 ATTCAGATCTATGGGAAAGAAGG + Intergenic
1028668604 7:93375203-93375225 TTTCAGTAGTATAGGTTACATGG + Intergenic
1034135955 7:148769906-148769928 TTTCAGTTTTATAGGAAAGATGG + Intronic
1037448501 8:18992156-18992178 ATTCAGTTATATAACTAATAAGG + Intronic
1038500370 8:28038626-28038648 ATTCATTTCTGCATGTAACAAGG - Intronic
1039899120 8:41737984-41738006 ACTCAGTTTTGTAGGGAACACGG + Intronic
1040846583 8:51848408-51848430 ATTCTGTCTTATAGGAAACATGG - Intronic
1042925775 8:73967139-73967161 GTTCATTTCTATATGTATCAAGG + Intronic
1043619749 8:82175364-82175386 ATTCAGATCGAAAGGTCACAGGG + Intergenic
1044057439 8:87588636-87588658 ATTCTGTTCTGTAGGCACCAGGG + Intronic
1044829526 8:96233565-96233587 CTTCATTTCTGAAGGTAACAGGG - Intronic
1047322315 8:123798702-123798724 ATTCATTTGTATACTTAACAAGG + Intronic
1048083068 8:131149499-131149521 AAGCAGTGCTATAGTTAACATGG + Intergenic
1048290701 8:133179324-133179346 CTTTACTTCTATAGGTAAAAAGG + Intergenic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1052432326 9:28382640-28382662 ATTCAGTTCTATGGGCCACATGG + Intronic
1053048378 9:34938303-34938325 CCTCAGTTCTTGAGGTAACAAGG - Intergenic
1054956062 9:70911768-70911790 AAGCAGTTGTATTGGTAACAGGG - Intronic
1055015642 9:71614956-71614978 ATTCTGTTCTATGGGAGACATGG - Intergenic
1055367202 9:75557216-75557238 ATTCAGTGCAATAGGTAACATGG + Intergenic
1056190062 9:84176241-84176263 CTTCAATTCTATCCGTAACATGG + Intergenic
1060715098 9:125918845-125918867 TTTCAGTTCTTTAGGGTACAAGG + Intronic
1060911277 9:127352997-127353019 ATTCAGTTCTGTAAGCAAAAGGG - Intronic
1186273873 X:7919398-7919420 ATCCAGTTCCATAGGTTAAAGGG + Intronic
1189801129 X:44692739-44692761 CTTCAGATCTAGAGGTAATAAGG + Intergenic
1190007440 X:46754350-46754372 ATACAGTTTTATAAGCAACAGGG + Intronic
1192507469 X:71697735-71697757 ATTCCGTTCTATGGGGAATAAGG + Intergenic
1192519227 X:71783817-71783839 ATTCCGTTCTATGGGGAATAAGG - Intergenic
1192546888 X:72021801-72021823 TTTCAATTCTATAGGCAAGAGGG - Intergenic
1193809041 X:86029885-86029907 ATTCAGTTCTGTTGTTAGCAAGG + Intronic
1197310475 X:124899202-124899224 ATGTAGTACTTTAGGTAACAAGG - Intronic
1197559211 X:127996959-127996981 GTGCATTTCTATATGTAACAGGG + Intergenic
1201448426 Y:14083387-14083409 ATTCAGTTCCACAGGTTACAGGG - Intergenic