ID: 1153900650

View in Genome Browser
Species Human (GRCh38)
Location 18:9614596-9614618
Sequence CGCGCGCGCCCCCGCCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 11, 3: 37, 4: 397}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153900650_1153900662 10 Left 1153900650 18:9614596-9614618 CCGGGCTGGCGGGGGCGCGCGCG 0: 1
1: 0
2: 11
3: 37
4: 397
Right 1153900662 18:9614629-9614651 CGAGGGCCCGGGCCTGCCGCGGG 0: 1
1: 0
2: 2
3: 33
4: 286
1153900650_1153900659 -1 Left 1153900650 18:9614596-9614618 CCGGGCTGGCGGGGGCGCGCGCG 0: 1
1: 0
2: 11
3: 37
4: 397
Right 1153900659 18:9614618-9614640 GCGGGGCGGGCCGAGGGCCCGGG 0: 1
1: 1
2: 7
3: 111
4: 812
1153900650_1153900666 18 Left 1153900650 18:9614596-9614618 CCGGGCTGGCGGGGGCGCGCGCG 0: 1
1: 0
2: 11
3: 37
4: 397
Right 1153900666 18:9614637-9614659 CGGGCCTGCCGCGGGCGGCGCGG 0: 1
1: 0
2: 3
3: 42
4: 423
1153900650_1153900658 -2 Left 1153900650 18:9614596-9614618 CCGGGCTGGCGGGGGCGCGCGCG 0: 1
1: 0
2: 11
3: 37
4: 397
Right 1153900658 18:9614617-9614639 CGCGGGGCGGGCCGAGGGCCCGG 0: 1
1: 1
2: 8
3: 124
4: 747
1153900650_1153900663 13 Left 1153900650 18:9614596-9614618 CCGGGCTGGCGGGGGCGCGCGCG 0: 1
1: 0
2: 11
3: 37
4: 397
Right 1153900663 18:9614632-9614654 GGGCCCGGGCCTGCCGCGGGCGG 0: 1
1: 1
2: 7
3: 53
4: 493
1153900650_1153900668 25 Left 1153900650 18:9614596-9614618 CCGGGCTGGCGGGGGCGCGCGCG 0: 1
1: 0
2: 11
3: 37
4: 397
Right 1153900668 18:9614644-9614666 GCCGCGGGCGGCGCGGCTCCCGG 0: 1
1: 0
2: 7
3: 44
4: 404
1153900650_1153900657 -7 Left 1153900650 18:9614596-9614618 CCGGGCTGGCGGGGGCGCGCGCG 0: 1
1: 0
2: 11
3: 37
4: 397
Right 1153900657 18:9614612-9614634 GCGCGCGCGGGGCGGGCCGAGGG 0: 1
1: 0
2: 4
3: 75
4: 459
1153900650_1153900656 -8 Left 1153900650 18:9614596-9614618 CCGGGCTGGCGGGGGCGCGCGCG 0: 1
1: 0
2: 11
3: 37
4: 397
Right 1153900656 18:9614611-9614633 CGCGCGCGCGGGGCGGGCCGAGG 0: 1
1: 2
2: 19
3: 157
4: 843
1153900650_1153900661 9 Left 1153900650 18:9614596-9614618 CCGGGCTGGCGGGGGCGCGCGCG 0: 1
1: 0
2: 11
3: 37
4: 397
Right 1153900661 18:9614628-9614650 CCGAGGGCCCGGGCCTGCCGCGG 0: 1
1: 0
2: 4
3: 36
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153900650 Original CRISPR CGCGCGCGCCCCCGCCAGCC CGG (reversed) Intronic