ID: 1153900656

View in Genome Browser
Species Human (GRCh38)
Location 18:9614611-9614633
Sequence CGCGCGCGCGGGGCGGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1022
Summary {0: 1, 1: 2, 2: 19, 3: 157, 4: 843}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153900650_1153900656 -8 Left 1153900650 18:9614596-9614618 CCGGGCTGGCGGGGGCGCGCGCG 0: 1
1: 0
2: 11
3: 37
4: 397
Right 1153900656 18:9614611-9614633 CGCGCGCGCGGGGCGGGCCGAGG 0: 1
1: 2
2: 19
3: 157
4: 843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153900656 Original CRISPR CGCGCGCGCGGGGCGGGCCG AGG Intronic