ID: 1153900703

View in Genome Browser
Species Human (GRCh38)
Location 18:9614731-9614753
Sequence AAGGCGGGAGGCGGGAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 2, 2: 1, 3: 55, 4: 410}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153900703_1153900715 5 Left 1153900703 18:9614731-9614753 CCGGCGCTCCCGCCTCCCGCCTT 0: 1
1: 2
2: 1
3: 55
4: 410
Right 1153900715 18:9614759-9614781 CTGCTTGCCGGGTCCCGGCCCGG No data
1153900703_1153900712 0 Left 1153900703 18:9614731-9614753 CCGGCGCTCCCGCCTCCCGCCTT 0: 1
1: 2
2: 1
3: 55
4: 410
Right 1153900712 18:9614754-9614776 TCCCGCTGCTTGCCGGGTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 119
1153900703_1153900709 -7 Left 1153900703 18:9614731-9614753 CCGGCGCTCCCGCCTCCCGCCTT 0: 1
1: 2
2: 1
3: 55
4: 410
Right 1153900709 18:9614747-9614769 CCGCCTTTCCCGCTGCTTGCCGG 0: 1
1: 0
2: 1
3: 11
4: 116
1153900703_1153900710 -6 Left 1153900703 18:9614731-9614753 CCGGCGCTCCCGCCTCCCGCCTT 0: 1
1: 2
2: 1
3: 55
4: 410
Right 1153900710 18:9614748-9614770 CGCCTTTCCCGCTGCTTGCCGGG 0: 1
1: 0
2: 2
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153900703 Original CRISPR AAGGCGGGAGGCGGGAGCGC CGG (reversed) Intronic