ID: 1153905570

View in Genome Browser
Species Human (GRCh38)
Location 18:9658489-9658511
Sequence ATGAGGTGATCAGGTCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153905561_1153905570 9 Left 1153905561 18:9658457-9658479 CCGTTTGCTCAGCCTGTCCCCCA No data
Right 1153905570 18:9658489-9658511 ATGAGGTGATCAGGTCTGCGAGG No data
1153905567_1153905570 -10 Left 1153905567 18:9658476-9658498 CCCAGGCAAGCACATGAGGTGAT No data
Right 1153905570 18:9658489-9658511 ATGAGGTGATCAGGTCTGCGAGG No data
1153905565_1153905570 -8 Left 1153905565 18:9658474-9658496 CCCCCAGGCAAGCACATGAGGTG No data
Right 1153905570 18:9658489-9658511 ATGAGGTGATCAGGTCTGCGAGG No data
1153905559_1153905570 26 Left 1153905559 18:9658440-9658462 CCTGGGGCAGTTTCCTGCCGTTT No data
Right 1153905570 18:9658489-9658511 ATGAGGTGATCAGGTCTGCGAGG No data
1153905563_1153905570 -3 Left 1153905563 18:9658469-9658491 CCTGTCCCCCAGGCAAGCACATG No data
Right 1153905570 18:9658489-9658511 ATGAGGTGATCAGGTCTGCGAGG No data
1153905566_1153905570 -9 Left 1153905566 18:9658475-9658497 CCCCAGGCAAGCACATGAGGTGA No data
Right 1153905570 18:9658489-9658511 ATGAGGTGATCAGGTCTGCGAGG No data
1153905560_1153905570 13 Left 1153905560 18:9658453-9658475 CCTGCCGTTTGCTCAGCCTGTCC No data
Right 1153905570 18:9658489-9658511 ATGAGGTGATCAGGTCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153905570 Original CRISPR ATGAGGTGATCAGGTCTGCG AGG Intergenic
No off target data available for this crispr