ID: 1153907740

View in Genome Browser
Species Human (GRCh38)
Location 18:9678042-9678064
Sequence CCTGGCCAACTCTAAATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153907734_1153907740 16 Left 1153907734 18:9678003-9678025 CCTCCCAAAGTACTGGAATTACA 0: 455
1: 21108
2: 326319
3: 263388
4: 141810
Right 1153907740 18:9678042-9678064 CCTGGCCAACTCTAAATTTTAGG No data
1153907730_1153907740 29 Left 1153907730 18:9677990-9678012 CCACCTGCCTTAGCCTCCCAAAG 0: 1339
1: 53212
2: 124540
3: 188356
4: 162728
Right 1153907740 18:9678042-9678064 CCTGGCCAACTCTAAATTTTAGG No data
1153907733_1153907740 22 Left 1153907733 18:9677997-9678019 CCTTAGCCTCCCAAAGTACTGGA No data
Right 1153907740 18:9678042-9678064 CCTGGCCAACTCTAAATTTTAGG No data
1153907737_1153907740 12 Left 1153907737 18:9678007-9678029 CCAAAGTACTGGAATTACAGGCG 0: 113
1: 7311
2: 147304
3: 292541
4: 220502
Right 1153907740 18:9678042-9678064 CCTGGCCAACTCTAAATTTTAGG No data
1153907731_1153907740 26 Left 1153907731 18:9677993-9678015 CCTGCCTTAGCCTCCCAAAGTAC 0: 75
1: 6675
2: 134802
3: 275423
4: 236387
Right 1153907740 18:9678042-9678064 CCTGGCCAACTCTAAATTTTAGG No data
1153907736_1153907740 13 Left 1153907736 18:9678006-9678028 CCCAAAGTACTGGAATTACAGGC 0: 305
1: 15279
2: 248726
3: 279537
4: 176759
Right 1153907740 18:9678042-9678064 CCTGGCCAACTCTAAATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153907740 Original CRISPR CCTGGCCAACTCTAAATTTT AGG Intergenic
No off target data available for this crispr