ID: 1153911251

View in Genome Browser
Species Human (GRCh38)
Location 18:9708249-9708271
Sequence GGCCGCCGGCCCCGCCGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 8, 3: 82, 4: 554}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153911251_1153911263 25 Left 1153911251 18:9708249-9708271 CCACCGCGGCGGGGCCGGCGGCC 0: 1
1: 0
2: 8
3: 82
4: 554
Right 1153911263 18:9708297-9708319 GCCCGCGGGCGGCGCGAGCGAGG 0: 1
1: 0
2: 4
3: 38
4: 326
1153911251_1153911265 26 Left 1153911251 18:9708249-9708271 CCACCGCGGCGGGGCCGGCGGCC 0: 1
1: 0
2: 8
3: 82
4: 554
Right 1153911265 18:9708298-9708320 CCCGCGGGCGGCGCGAGCGAGGG 0: 1
1: 0
2: 0
3: 16
4: 142
1153911251_1153911261 14 Left 1153911251 18:9708249-9708271 CCACCGCGGCGGGGCCGGCGGCC 0: 1
1: 0
2: 8
3: 82
4: 554
Right 1153911261 18:9708286-9708308 GCGGCGGTTCCGCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 101
1153911251_1153911259 10 Left 1153911251 18:9708249-9708271 CCACCGCGGCGGGGCCGGCGGCC 0: 1
1: 0
2: 8
3: 82
4: 554
Right 1153911259 18:9708282-9708304 AGCGGCGGCGGTTCCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 105
1153911251_1153911257 -2 Left 1153911251 18:9708249-9708271 CCACCGCGGCGGGGCCGGCGGCC 0: 1
1: 0
2: 8
3: 82
4: 554
Right 1153911257 18:9708270-9708292 CCCAGAAATAGCAGCGGCGGCGG 0: 1
1: 0
2: 1
3: 19
4: 159
1153911251_1153911267 27 Left 1153911251 18:9708249-9708271 CCACCGCGGCGGGGCCGGCGGCC 0: 1
1: 0
2: 8
3: 82
4: 554
Right 1153911267 18:9708299-9708321 CCGCGGGCGGCGCGAGCGAGGGG 0: 1
1: 0
2: 4
3: 27
4: 198
1153911251_1153911255 -5 Left 1153911251 18:9708249-9708271 CCACCGCGGCGGGGCCGGCGGCC 0: 1
1: 0
2: 8
3: 82
4: 554
Right 1153911255 18:9708267-9708289 CGGCCCAGAAATAGCAGCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 66
1153911251_1153911260 11 Left 1153911251 18:9708249-9708271 CCACCGCGGCGGGGCCGGCGGCC 0: 1
1: 0
2: 8
3: 82
4: 554
Right 1153911260 18:9708283-9708305 GCGGCGGCGGTTCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 20
4: 153
1153911251_1153911254 -8 Left 1153911251 18:9708249-9708271 CCACCGCGGCGGGGCCGGCGGCC 0: 1
1: 0
2: 8
3: 82
4: 554
Right 1153911254 18:9708264-9708286 CGGCGGCCCAGAAATAGCAGCGG 0: 1
1: 0
2: 1
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153911251 Original CRISPR GGCCGCCGGCCCCGCCGCGG TGG (reversed) Exonic
900195706 1:1374616-1374638 GGCCACCGGCCCTGCCCCAGCGG + Intronic
900226240 1:1534832-1534854 GGCCCCTGGCCCCGCAGTGGCGG - Intergenic
900287538 1:1908831-1908853 AGCAGCCGCCCGCGCCGCGGAGG - Intergenic
900417232 1:2540739-2540761 GGCCGCACGCCCCGCCCCGCCGG + Intergenic
900970967 1:5992257-5992279 GGCCTCCGGCGCGGCCGCGGCGG - Exonic
901065465 1:6492126-6492148 GGCCGCCTCCCCCGCTGCGGTGG - Intronic
901637826 1:10678490-10678512 GGCCTCGGGCCCCCTCGCGGGGG - Intronic
901818007 1:11805917-11805939 GGCCGCCGGCCGCACCACTGTGG + Intronic
902823162 1:18955890-18955912 GGCGGCCTGCCCCCCGGCGGCGG - Exonic
903349977 1:22711401-22711423 GGGCGCGGGCCCGGCCGTGGCGG + Intronic
903420916 1:23217406-23217428 GGCCGCCCGCCCCGCCGCCCCGG + Intergenic
903468449 1:23568406-23568428 GGCGCCTGGCCCCGCCGCGGCGG - Intergenic
903614757 1:24643556-24643578 GGCCACCGTCGCCGCCGCGTAGG - Intronic
903652326 1:24929787-24929809 TGCCGCCGCCGCCGCCGCAGGGG + Exonic
903750404 1:25617469-25617491 AGGCGCGGGCCCCGGCGCGGCGG + Exonic
904181436 1:28669091-28669113 CGCAGCCGGCCGCGCCGCCGGGG + Intronic
904318300 1:29680231-29680253 GGCCCCCTGGCCCGCCGCAGGGG + Intergenic
904485939 1:30824608-30824630 GGCCGGCGCCCCCGCCGGGGCGG + Intergenic
904641952 1:31937941-31937963 GGCCCCCGGCGCCGGCGCGGGGG + Intronic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904744464 1:32702621-32702643 CGGCGCCGTCCCCGCCGCGCCGG + Exonic
904753221 1:32754018-32754040 GGCCGCCGGGCCCGCAGCCCCGG - Intronic
904973942 1:34441719-34441741 GGCCGGCGGCTCCGCAGGGGAGG + Intergenic
905043239 1:34977108-34977130 GGCCGCCTGCCACGCGGCCGGGG - Intergenic
905066890 1:35192251-35192273 GGCCGCCGGGCCCGCCGGGCGGG + Exonic
905442795 1:38005582-38005604 GGCCCCCCAGCCCGCCGCGGGGG + Intronic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
908501110 1:64744900-64744922 GGCCCCCGGCCCCGGCGCACAGG - Intergenic
908796247 1:67833447-67833469 GGGCGCCGGCTCCGCCTCGCTGG + Exonic
909001414 1:70221678-70221700 CGCCACCGGGCCCGCCGCTGGGG - Exonic
911116085 1:94247748-94247770 GGCGGCCGGCGCAGCCGTGGCGG - Intronic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
912315094 1:108661124-108661146 GGGCGCCGGCGTAGCCGCGGCGG - Intronic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
914197337 1:145454429-145454451 CCCCGCCGGCCCCGCCGCCCCGG + Intergenic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
915564669 1:156706802-156706824 GGCCGAAGGCCCCCCCGCGTTGG - Intergenic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916666942 1:166975397-166975419 GCCCGCCGGGCCGGCCGCGCAGG + Intronic
917345182 1:174022158-174022180 GGCAGCCGCCGCCGCCGCCGAGG + Exonic
917788856 1:178486915-178486937 GGCCGCTGGGCCCGCGGAGGCGG + Intergenic
917846727 1:179026130-179026152 GACCCCCGCCCCCGGCGCGGCGG + Intronic
919712095 1:200738936-200738958 AGCCGCCGCCGCCGCCGCTGCGG - Intergenic
919981104 1:202643384-202643406 CCCCGCCGGCCCTGCCGCTGCGG + Exonic
920171242 1:204073583-204073605 GCCCGCCCGCCGCGTCGCGGGGG + Exonic
920451698 1:206064625-206064647 GGCCGGCCGCCCCGTCCCGGGGG + Intronic
920655097 1:207868844-207868866 CGCTGCTGGCCTCGCCGCGGGGG - Intergenic
921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG + Exonic
922753736 1:228082871-228082893 TGTCGCCGCCGCCGCCGCGGGGG - Intronic
923684192 1:236142590-236142612 GGCCGCCGCCGCCCCCGCGGGGG - Exonic
923783022 1:237042490-237042512 GGGAGCCGGCCCCGGCGAGGAGG + Exonic
924502884 1:244653253-244653275 GGCCTCCGGCCCCGCGGAGACGG + Exonic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1064028796 10:11869977-11869999 CGGCGCCTTCCCCGCCGCGGGGG + Exonic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064645374 10:17454334-17454356 CGCCGCCGCCACCGCCGCCGTGG + Intergenic
1065099836 10:22321716-22321738 GGCCCCCAGCCCCGTCCCGGGGG - Intronic
1066180633 10:32958049-32958071 AGCCGCCGGCCGGGCCGCGCCGG - Intronic
1066370461 10:34815003-34815025 GGGCGCGGGCCCGCCCGCGGCGG - Exonic
1066429345 10:35336888-35336910 GGCCGCCGGGTCAGCAGCGGCGG - Exonic
1066464696 10:35641600-35641622 GGCTGCGGGCCGCGCCGCTGCGG - Exonic
1067084155 10:43229409-43229431 GTCCGCGGGCCGCGCCGCGAAGG + Intronic
1067346085 10:45440096-45440118 GGCCGAAGGCCCAGCAGCGGAGG - Intronic
1068910500 10:62374316-62374338 CGCCGCCGGTCCCGGCGCGGAGG + Exonic
1069769352 10:70887922-70887944 CGCCCCCGCCCCCGCCCCGGGGG + Intronic
1069992955 10:72326051-72326073 GCCCGCCGGCCCTGCCGCCCCGG + Intergenic
1070290667 10:75111520-75111542 GGCCGCCGTCACCGCCGCGCCGG - Intronic
1070570643 10:77637740-77637762 TGCCGCCGCCGCCGCCGCCGCGG + Intronic
1070579645 10:77710122-77710144 GGCAGCAAGCCCCGCCCCGGTGG + Intergenic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1072719501 10:97771932-97771954 AGCCGCCGCCGCCGCCGCCGCGG + Exonic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1072891674 10:99329972-99329994 AGCCGCCGGCGGCGCCGTGGTGG - Exonic
1073531067 10:104232314-104232336 GGCCCGCAGCCCCGCGGCGGCGG - Exonic
1074065360 10:110008212-110008234 AGCCGCCGGATCCGCCGCTGCGG - Exonic
1075031907 10:119029646-119029668 GCCCCCCGGCCTCGCCGCCGCGG - Intergenic
1076371452 10:129958777-129958799 GGCCGCGCGCCGGGCCGCGGAGG - Intronic
1076637368 10:131891299-131891321 GGCCGCCTGCCTCCTCGCGGTGG + Intergenic
1076638910 10:131901015-131901037 CGCCGCCGCCGCCGCCGGGGAGG - Exonic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076668240 10:132104858-132104880 GGCCGCCTGCAGCGCCGCGAGGG - Exonic
1077010402 11:376845-376867 GGCCGCCGGTCCTGCGGCCGTGG - Exonic
1077102191 11:827325-827347 GACCGCTGGTCCCGCCGCTGAGG + Intronic
1077124364 11:925925-925947 GGTCGCCGTCACCGCCGCGGAGG - Exonic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1077419837 11:2444986-2445008 TGCTGCCAGCCCCGCCGCGGGGG - Exonic
1078233210 11:9461124-9461146 GGCCGCCGCCCTCAGCGCGGCGG + Intronic
1079128639 11:17735296-17735318 GGCAGGCGGGCCCGCCGCCGGGG + Exonic
1080628342 11:34051556-34051578 GTCCCCCGGCCCCGGCGCTGTGG - Intergenic
1082007292 11:47426468-47426490 GGCCACAGGCCCCGCCCCCGCGG + Exonic
1082076615 11:47980465-47980487 AGCCGCCGGGCCGGCCGGGGCGG + Intergenic
1082214979 11:49558562-49558584 GGCTGCGGGGCCCGCGGCGGTGG - Intergenic
1083265761 11:61546204-61546226 CACCGCCAGCCCCGCCGCGGCGG + Exonic
1083289177 11:61680390-61680412 GGGCGCCGGCGCCGGCGCGAAGG - Intergenic
1083772979 11:64878669-64878691 GGCGGCTAGCGCCGCCGCGGCGG + Exonic
1083813230 11:65117126-65117148 GGCCGCGGGCTCCGCGGCGGAGG + Exonic
1083886137 11:65574326-65574348 CGCCCCCAGCCCCGCCCCGGCGG - Intergenic
1083940122 11:65891230-65891252 CGCCGCTGGGGCCGCCGCGGGGG - Exonic
1083965794 11:66042953-66042975 GGCCGCCATCCCCGCGGCGCTGG - Exonic
1083970307 11:66070406-66070428 CCCCGCCGCCGCCGCCGCGGGGG + Intronic
1084086443 11:66857304-66857326 GGCCGCCGGGCGCAGCGCGGGGG + Intronic
1084310154 11:68312350-68312372 GGCCGCCGGGCCCCGCGGGGCGG + Intergenic
1084646791 11:70463614-70463636 GGGCGAAGGCCCCGCCGCTGCGG + Intergenic
1086634602 11:89065907-89065929 GGCTGCGGGGCCCGCGGCGGTGG + Intronic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1086981016 11:93197877-93197899 TGACGCCGGCCACGCAGCGGCGG - Exonic
1087175269 11:95090052-95090074 GGCCGCCAGCCCCGCAGGCGGGG - Exonic
1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG + Exonic
1091549989 12:1530119-1530141 GCCCGGGGGCCTCGCCGCGGGGG - Intronic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1095349144 12:41188780-41188802 GCCCGCCGGCTCCGCAGCCGCGG + Exonic
1096981241 12:55729078-55729100 GGCCGGCGGCCACTCGGCGGGGG - Intronic
1096983733 12:55743388-55743410 GGCCGAGGGCCCCGCGGCGGCGG + Exonic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1098819129 12:75207701-75207723 GGTCGCTGGCCCTGCCGCCGCGG + Exonic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1102278169 12:111598739-111598761 GGACGCCGGGCCCGGAGCGGAGG + Intronic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102678062 12:114672020-114672042 GGCCGCCAGCCCGGCCTCGGTGG - Exonic
1102925003 12:116819654-116819676 GGCCACCAGCCCCGCCCCGCTGG + Intronic
1103386311 12:120534927-120534949 GCCGGCTGGCCCCGCCGAGGCGG - Exonic
1103521249 12:121537912-121537934 AGCCGCCGCCGCCGCCGCCGAGG - Intronic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1103954256 12:124567597-124567619 CGCCGCCGCCACCGCCGCCGCGG - Intergenic
1104897800 12:132172795-132172817 GGCCGCCGCCCTCGCCCCTGCGG - Intergenic
1105964428 13:25371983-25372005 GCCAGCGGGGCCCGCCGCGGTGG + Intergenic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1107086287 13:36431410-36431432 GGCGGGCGGCCCGGCCGCGTGGG - Intergenic
1107467520 13:40664743-40664765 GGCGCCCGGCCCCGACGCGCTGG + Intronic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107605097 13:42048824-42048846 GGCCGCCGGAGCCGGCGCCGCGG + Exonic
1108370416 13:49762218-49762240 GGCCAGCCGCCCCGTCGCGGAGG + Intronic
1108408301 13:50125420-50125442 CGGCGCGGGCCCCGCCGAGGGGG - Intronic
1108541993 13:51453378-51453400 GGCCGGCGGCCCTGACGCGCAGG - Intronic
1110450860 13:75636286-75636308 CGCCGCCGTCCTCCCCGCGGTGG - Intronic
1110558390 13:76885714-76885736 GGCCGCCGCCCTCGCGGCGCGGG - Exonic
1110629996 13:77697555-77697577 GGCTGCCGGCCCCGCCCCCTGGG + Intergenic
1111951318 13:94711551-94711573 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1112321313 13:98410211-98410233 GGCAGCCAGCCCCACCGTGGAGG - Intronic
1112365609 13:98752724-98752746 GGCCGCCGGCTCCACCCGGGGGG + Intergenic
1112402212 13:99086744-99086766 GGCCCGCCGTCCCGCCGCGGCGG - Intergenic
1112507198 13:99982135-99982157 AGCCGCCGCCGCCGCCGCGGCGG - Exonic
1112507199 13:99982138-99982160 GGCAGCCGCCGCCGCCGCCGCGG - Exonic
1113200999 13:107867343-107867365 GCCCGCGGGCGCCGCCGCCGGGG + Intergenic
1113494150 13:110714383-110714405 AGCGGCCGGCTCCGCAGCGGCGG + Intronic
1113656099 13:112068501-112068523 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
1113853121 13:113429151-113429173 GGCCGCCCGCCACGCTGCGTGGG + Intronic
1114485170 14:23057655-23057677 CGCCCCCGCCCCCGCCGCGCGGG - Intergenic
1115398582 14:32934893-32934915 GGCCGGCGGGGCGGCCGCGGGGG + Intergenic
1115399317 14:32939415-32939437 CGCCGCCGCCTCCGCCGCCGAGG + Intronic
1115592190 14:34874900-34874922 GGCAGGACGCCCCGCCGCGGGGG + Intronic
1115769342 14:36654533-36654555 GGCCCTCGGGCCCGCCTCGGAGG + Intergenic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1119520155 14:75279138-75279160 AGCCCCCGGCCCCGCGGCGACGG - Intronic
1119743210 14:77027297-77027319 CGCCGCCGCCGCCGCTGCGGTGG - Exonic
1119743212 14:77027300-77027322 CGCCGCCGCCGCCGCCGCTGCGG - Exonic
1121074948 14:91060290-91060312 GCCGGCCGGGCCCGGCGCGGGGG - Intronic
1121616958 14:95319817-95319839 GCCCGCCGCCCGCGCCGCGCTGG - Exonic
1122221169 14:100239799-100239821 CCGCGCCGGCCCCGCCGCTGAGG - Exonic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122978561 14:105181086-105181108 GGCCGCCGGCGGGGGCGCGGGGG + Intronic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124496797 15:30192114-30192136 CCCCGCCGGCCCTGCCGCTGCGG + Intergenic
1124628779 15:31325937-31325959 GGCGGCCGGCGCCGCTGCTGAGG - Intergenic
1124746779 15:32346533-32346555 CCCCGCCGGCCCTGCCGCTGCGG - Intergenic
1125200735 15:37099011-37099033 CGCCGCCGGGGCCGCCGCTGGGG - Intronic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1125631588 15:41151779-41151801 GCCAGCCGGCCCCGCCGCCTCGG + Intergenic
1125684985 15:41558854-41558876 GGGCGCCGGCGGGGCCGCGGGGG + Intronic
1126295726 15:47133349-47133371 GGCCGGCCGCCCCGTCGGGGAGG + Intergenic
1126849868 15:52790365-52790387 CGCCGCCGCCGCCGCCGCAGCGG + Intronic
1128056387 15:64702922-64702944 GGCGGATGGCCCCGCTGCGGGGG + Intronic
1128067853 15:64775591-64775613 TGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1128149757 15:65355543-65355565 GGCGGCCGGGCCCGAGGCGGGGG + Intronic
1128797243 15:70474885-70474907 GGCCGCCGGCCGCCCCGGTGAGG - Intergenic
1128970623 15:72101886-72101908 GGCCAGCGGCCCCGCCCGGGAGG + Intronic
1129676003 15:77632690-77632712 GCCCGCCGGCCCCGGCCCCGCGG - Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1129780119 15:78264537-78264559 AGCCACCGGCTCCTCCGCGGCGG - Intronic
1131160619 15:90102504-90102526 GCCCGGCAGCCCCGCCCCGGTGG - Exonic
1131257378 15:90871547-90871569 GGGCGCCCGAGCCGCCGCGGCGG + Intronic
1131367781 15:91854144-91854166 GGCCGCCTGGCCCGACGAGGGGG + Intronic
1132004513 15:98214523-98214545 TGCCACCGGCCGTGCCGCGGGGG + Intergenic
1132519834 16:381982-382004 GCCCGCAGGCCCCGCCCCGCAGG + Exonic
1132641488 16:980502-980524 GGCCACCGGCCCGGGCGTGGGGG + Intronic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132779506 16:1614792-1614814 GGCCGTCGGCGCCGGCCCGGGGG - Exonic
1132828897 16:1918143-1918165 GGCCGCCCGCGCCCCCGCGCCGG - Exonic
1132828936 16:1918284-1918306 CGCCCCCGGCCCCGCCGCCCAGG + Exonic
1132883791 16:2173599-2173621 GGCCGGCGGCCCCGGCAGGGAGG + Intronic
1133277451 16:4647328-4647350 GGCCCCTGGCCCCGCCCCGTAGG + Intronic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1133784416 16:8963577-8963599 GGAGGCGGGCCCCGCGGCGGCGG - Intronic
1134588744 16:15434868-15434890 AGCTGCCAGCCCCGCTGCGGGGG - Intronic
1135296537 16:21283933-21283955 CGCCGCCGCCTCCGCCGCTGCGG - Intronic
1136226401 16:28863436-28863458 GAGCGCCGGCCCCGCTGTGGAGG - Intronic
1136426386 16:30170347-30170369 GGCCAGCGGCCCCGCCCGGGAGG + Intergenic
1136867777 16:33770536-33770558 TGCCGCCGTCGCCGCCGCCGCGG + Intergenic
1138179745 16:54933239-54933261 CGCCGCTGGCCCAGCCGGGGAGG - Exonic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1138961575 16:62035543-62035565 GGCCCGCAGCCCTGCCGCGGGGG + Intronic
1139570248 16:67807036-67807058 TGACTCCGCCCCCGCCGCGGGGG + Intronic
1139598124 16:67969641-67969663 GGTCGGCGGGCCCGCTGCGGGGG - Intergenic
1139806177 16:69566570-69566592 GGCCGGCGGCTCCGCGGGGGAGG - Intronic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1141553206 16:84819859-84819881 CGCCCCCGGCCCCGCCCCGCAGG - Intergenic
1141608762 16:85169905-85169927 GGGCCCCGGCGCCGCCACGGCGG - Intergenic
1141683375 16:85556632-85556654 GGGAGCCGGCTCCGCCGCGGCGG + Intergenic
1141683380 16:85556646-85556668 GGCCGCTCGCTCCGCCGCCGCGG - Intergenic
1141784930 16:86193205-86193227 GGCCGCCTGCCCTGCCACGGAGG - Intergenic
1142163333 16:88570625-88570647 GGCCGCCGCCGCCGCCTCGGCGG - Intronic
1142695192 17:1629340-1629362 CGCCGCCGTCCCCGCCGCCTCGG + Intergenic
1142752734 17:1998319-1998341 GGGCACCGGCCCCGCCCGGGAGG + Intronic
1143155537 17:4833786-4833808 GGGCGGGGGCCCAGCCGCGGCGG - Intronic
1144724848 17:17496620-17496642 GGCCGCCGAGCCCGCGGCAGTGG - Intergenic
1146219839 17:31008727-31008749 GCCCGCCGCCTCCGCCGCTGGGG + Intergenic
1146716245 17:35089191-35089213 GGCTGCGGACTCCGCCGCGGCGG + Exonic
1146955975 17:36936594-36936616 GCCCGCCGTCCGCGCCGCGCGGG + Intergenic
1147168648 17:38605827-38605849 GGGCGCGGGCCCCGCCGGGGTGG + Exonic
1147740793 17:42670097-42670119 TGCGGCCGGCCCCGCCGCGCCGG + Exonic
1148632870 17:49125721-49125743 GGCCGGCCGCCCCGTCCCGGAGG + Intergenic
1148664077 17:49361852-49361874 TGCCGGGGGCGCCGCCGCGGCGG + Intronic
1148849308 17:50547176-50547198 GGCCGTGGGCCCGGCCGCTGAGG - Exonic
1148850169 17:50550744-50550766 GGCCGCTGGCCCCGCTCTGGGGG - Exonic
1148852197 17:50560811-50560833 CGCCGCCGCAGCCGCCGCGGTGG - Intergenic
1149849395 17:60026306-60026328 GGTCTGCGGCCCCGCGGCGGGGG - Intergenic
1149860773 17:60120218-60120240 GGTCTGCGGCCCCGCGGCGGGGG + Intergenic
1150373505 17:64661883-64661905 CCCCGCCGCCCCCGCCGCCGGGG - Exonic
1150423169 17:65056599-65056621 CGCCGCCGCCGCCGCCTCGGCGG + Exonic
1151724062 17:75874649-75874671 GCCTCCCGGCCCCGCCGGGGTGG - Exonic
1152222209 17:79075059-79075081 GGCCGCCGCCGCCGCGGCCGCGG - Exonic
1152291666 17:79443272-79443294 TGCCACCGGCCTCGCCACGGGGG + Intronic
1152552318 17:81035706-81035728 GCCCGCCGCCCCCGCCGCCCCGG - Intronic
1152697590 17:81804587-81804609 GGCCCCGGGCCCCGCCGCCCTGG + Intronic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153514493 18:5891385-5891407 GGCCGCCGCGGCCGCCGCCGCGG - Exonic
1153515138 18:5895362-5895384 GGCCGGCGGCGCGGCCGCAGGGG - Exonic
1153794605 18:8610165-8610187 GGCCCCCGGCCCTGCCTCAGAGG + Intronic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1155199351 18:23503593-23503615 GGGCGCCGCGCCCGCGGCGGGGG - Exonic
1156275821 18:35581807-35581829 GTCCTCCGGGCCGGCCGCGGCGG - Intronic
1157464207 18:47930538-47930560 GGCCGGCGGCCCGGGCGCGCGGG + Exonic
1160719161 19:589995-590017 CGGCGGCGGCCCCGGCGCGGGGG - Exonic
1160814437 19:1028682-1028704 GGCCGGCGGCCGGGCAGCGGGGG + Intronic
1160830998 19:1104802-1104824 GGCCGCGAGCCCCTCGGCGGCGG + Intronic
1160861278 19:1238100-1238122 GCCCCCCGCACCCGCCGCGGCGG + Intergenic
1160873100 19:1285885-1285907 CGCCGCCGCACCCGCCGGGGAGG - Intergenic
1160970806 19:1766979-1767001 GGCCCCGGGCTCCGCTGCGGGGG + Intronic
1161006857 19:1941389-1941411 GCCCGCGGGCCCGGCCACGGCGG + Exonic
1161265236 19:3360587-3360609 GGCCGCGGGTCCCGGCGCGTCGG + Intronic
1161471256 19:4457701-4457723 GGCGGCTGGCCCGGCGGCGGGGG + Exonic
1161585188 19:5101980-5102002 GGCCGCCTGCCCCTCCTCGCTGG - Intronic
1161959551 19:7516202-7516224 GGCGGCCGGCGCGGGCGCGGCGG + Exonic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1162079440 19:8209547-8209569 GGTCCCCGGCCCCGCCTCCGCGG + Intronic
1162113312 19:8413197-8413219 GGCCTCCGGCCCCGCCTCTTAGG + Intronic
1162128237 19:8510867-8510889 GCGCGGCGGCCCGGCCGCGGGGG + Exonic
1162345531 19:10115997-10116019 GGCGGCTGGCCCCGTCGCGCAGG + Exonic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162751856 19:12834151-12834173 GGCCGCGCGTCCCGCCGCGCTGG + Intronic
1163158043 19:15449684-15449706 CGCCCCCGCCCCCGCCCCGGGGG + Intronic
1163262274 19:16198334-16198356 AGCCCCCGGCCCCGGCGCCGGGG - Intronic
1163320475 19:16571894-16571916 GGCGGCCGGGCCCGCCGCTTCGG - Intronic
1163320568 19:16572325-16572347 GGGCGCGGGCCACGGCGCGGGGG - Exonic
1163587926 19:18173900-18173922 GGACGCCTGCACCGCCGCCGTGG - Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1164051156 19:21586633-21586655 GGCCGCCCGCCCCGGCGCGGAGG - Intergenic
1164881237 19:31734363-31734385 GGGCTCCGGCCCTGCCTCGGAGG + Intergenic
1165591394 19:36972880-36972902 GGCGGCCGGGCCCGCCGCCAGGG - Intronic
1165850965 19:38850048-38850070 AGCCACTGGTCCCGCCGCGGGGG + Exonic
1165851394 19:38852058-38852080 GGCGTCCGGGCCGGCCGCGGGGG - Intronic
1166001054 19:39877699-39877721 GGCCGCCTGCCAGGCCGCTGGGG - Exonic
1166219057 19:41353692-41353714 CGCCGCCGCCCCCGCCACTGCGG - Exonic
1166313929 19:41978177-41978199 GGCAGCCGTCCCTGACGCGGTGG - Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166529726 19:43535097-43535119 GGCCGCCGGCGAGGCCGGGGAGG - Exonic
1166754076 19:45179742-45179764 CGCCGCCAGCCCCGCCGCCTGGG - Exonic
1166876559 19:45901455-45901477 GGGCGCCGGGCCCGCCGCGGAGG - Exonic
1167149629 19:47701476-47701498 AGCCGCCTGCCCCGCCGTGCCGG - Exonic
1167237175 19:48322063-48322085 GGCAGCAGCCGCCGCCGCGGAGG - Intronic
1167258124 19:48443087-48443109 GCCCGCCGGCGCCCGCGCGGTGG + Exonic
1168064056 19:53909423-53909445 GGCCGCCGCCGCCGCCACCGGGG - Exonic
1168073069 19:53963337-53963359 CGCCGCCGCCCCCGCGGTGGGGG - Exonic
1168718997 19:58544700-58544722 GGGCGCGGGGCCCGCCGCGCAGG - Exonic
1168721776 19:58558404-58558426 GGTCCCGGGCCCCGCGGCGGCGG - Exonic
1202693104 1_KI270712v1_random:105089-105111 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693116 1_KI270712v1_random:105133-105155 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693128 1_KI270712v1_random:105177-105199 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693140 1_KI270712v1_random:105221-105243 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693152 1_KI270712v1_random:105265-105287 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693164 1_KI270712v1_random:105309-105331 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693176 1_KI270712v1_random:105353-105375 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693188 1_KI270712v1_random:105397-105419 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693200 1_KI270712v1_random:105441-105463 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693211 1_KI270712v1_random:105485-105507 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693223 1_KI270712v1_random:105529-105551 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
925039777 2:722746-722768 GGCTCCCGGCCCAGCCGCAGTGG - Intergenic
925182105 2:1824000-1824022 GCCCGGCGGCCCCGCTGGGGGGG - Intronic
926718622 2:15942699-15942721 GACCGCAGGGCCCGCCGCCGGGG - Exonic
927126083 2:20012992-20013014 GGGCGCAGGCCCCGCTGGGGTGG - Intergenic
927159218 2:20242386-20242408 GGCCCCCGGACCCGCGGCGCAGG + Intergenic
927472221 2:23385254-23385276 CGCCGCCGTCCCCGCCACCGCGG + Exonic
927552139 2:24010072-24010094 GGCCGCGGGCGGCGCTGCGGTGG + Exonic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
927920772 2:26970702-26970724 GGCCGGCGGCTCCGGGGCGGAGG - Exonic
928149088 2:28810519-28810541 GGCCGCAGCCCCAGCCCCGGGGG + Intronic
928549518 2:32357286-32357308 CGCCCCCGCCCCCGCCGCCGAGG - Exonic
928983184 2:37156821-37156843 GGCTGCAGGCCCAGCCGGGGCGG - Intronic
931254111 2:60555286-60555308 AGCCGCCGCCGCCGCCGCCGGGG + Intergenic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
932722480 2:74147989-74148011 GCCTCCCGGCCCCGCCCCGGAGG + Exonic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
934031861 2:88055595-88055617 GGCCGCCCCCGCCGCCGGGGCGG + Intronic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934846362 2:97663695-97663717 GGCCGCTGGCTTCGCCCCGGGGG - Intronic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592618 2:104855840-104855862 TGCCGCCGCCGCCGCCGTGGAGG + Exonic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
936038322 2:109129642-109129664 GGCGGCGGCCACCGCCGCGGGGG + Exonic
937869505 2:126777185-126777207 GGCAGGCGGCCTGGCCGCGGAGG + Intergenic
941905574 2:170714673-170714695 TGCCCTCGGCCCCACCGCGGCGG + Intergenic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942450899 2:176107580-176107602 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
942459045 2:176157142-176157164 GGCCGCCCAGCCCGGCGCGGGGG - Intronic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944414766 2:199470254-199470276 GGTCGCAGCCCCTGCCGCGGAGG + Intronic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
946327670 2:218993144-218993166 GGGCGCCGGGCCCGGCGCGGGGG + Exonic
947794444 2:232885217-232885239 GGCCCCTGGCCCCGCCCCAGAGG - Intronic
947819535 2:233060444-233060466 GCCTGCCGGCCCGGCCGAGGAGG + Exonic
948207260 2:236168704-236168726 CGCCCCCGGCCCAGCCGTGGGGG - Intergenic
948932316 2:241139899-241139921 GGCCGACGGCCACGCTGCGGTGG - Exonic
948953993 2:241272899-241272921 GCCCGCCCGCCCCGCCGCTGGGG + Intronic
1168753080 20:297589-297611 GGCCACCGGCGGCGGCGCGGAGG + Exonic
1169214737 20:3786521-3786543 GGCCCCCCGCCCCGGGGCGGCGG - Exonic
1169216297 20:3796513-3796535 TTCTGCCGGCCCCGCCGCGATGG + Exonic
1169438079 20:5611037-5611059 GCCCTCCGGCCCCGCCCCGCGGG - Intergenic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1170889945 20:20368327-20368349 GGTCGCCGTCCTCGCCGCCGCGG - Exonic
1171361620 20:24590273-24590295 GGCCCCCAGCCCCGCCGCGCCGG - Intronic
1173279842 20:41618255-41618277 GGTCCCCGGCCCCGCCCCGCCGG - Intronic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1174258796 20:49278262-49278284 GCCCGCCGGCTCCGCCGCCGGGG - Intronic
1174287771 20:49484198-49484220 AGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1174386561 20:50191167-50191189 GGCCGCGGGGGGCGCCGCGGGGG - Exonic
1175429579 20:58891881-58891903 GGGCGCCGGCCCCGGCCCGGGGG + Intronic
1175847021 20:62064838-62064860 GGCCGCCGGGGGCCCCGCGGGGG - Exonic
1175847213 20:62065312-62065334 GCCCGCCGGCCCCGCCGCGCTGG - Exonic
1175947327 20:62565022-62565044 GGCCGCAGGTCCCGCAGCCGTGG + Exonic
1176005662 20:62861190-62861212 GGCCGACGGCGCCGCCAAGGAGG - Exonic
1176054448 20:63136426-63136448 GGCAGCCGGCCCCGGCGAAGAGG + Intergenic
1176068917 20:63216005-63216027 GGGCGCCGGCCGGGCGGCGGCGG + Exonic
1176178532 20:63739509-63739531 GCCCGCGCGCCCCGCCGGGGAGG - Intronic
1176232287 20:64038613-64038635 GGCCGCCGGCTCCGCTGTCGGGG - Intronic
1176547349 21:8207651-8207673 GGACGCCGGGCCCGGCCCGGCGG - Intergenic
1176548463 21:8211879-8211901 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176555254 21:8251860-8251882 GGACGCCGGGCCCGGCCCGGCGG - Intergenic
1176556357 21:8256087-8256109 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176566300 21:8390698-8390720 GGACGCCGGGCCCGGCCCGGCGG - Intergenic
1176567394 21:8394914-8394936 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575296 21:8439129-8439151 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178334549 21:31731842-31731864 GGCCGCCCGCCTCGCCGCTTCGG - Exonic
1178493852 21:33070948-33070970 GGCCGCCTGCGCCGCCGCCGGGG - Exonic
1179882677 21:44300096-44300118 GGCCGCCGCCATGGCCGCGGTGG + Exonic
1180005421 21:45018560-45018582 GGCCGCCGAGCCCGCTGCGAGGG + Intergenic
1180064452 21:45405510-45405532 GCCCGCCGGCCTCGCCGCCCTGG + Intronic
1180216202 21:46324915-46324937 GGCGGCCGGGAGCGCCGCGGGGG - Intronic
1180342204 22:11628242-11628264 GCCCTCCGTCCCCACCGCGGAGG - Intergenic
1180801591 22:18634490-18634512 GGCCGCGGGGCGCGGCGCGGGGG - Intergenic
1180852834 22:19030029-19030051 GGCCGCGGGGCGCGGCGCGGGGG - Intergenic
1180981276 22:19879275-19879297 GGCCGCAGGCCCCACCGCCCAGG + Intronic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181094280 22:20495382-20495404 GGCCGCCCGCTCCAGCGCGGAGG + Intronic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1181934474 22:26429183-26429205 GGTCCCCGGCCCCGCCCCGCAGG + Intergenic
1182289860 22:29268650-29268672 GGCCGCAGGCCCCGCCCACGTGG - Intronic
1182532264 22:30969466-30969488 GGGCGCAGGCCCGGCCGCCGCGG + Intergenic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1183525002 22:38317495-38317517 GCCCGCCGCCGCCGCCCCGGAGG + Intronic
1183683767 22:39350206-39350228 GGCCCCCGGCGGCGGCGCGGCGG + Intronic
1185055265 22:48575865-48575887 CGCCGCCACCGCCGCCGCGGCGG - Intronic
1185055267 22:48575868-48575890 CGCCGCCGCCACCGCCGCCGCGG - Intronic
1185349576 22:50327394-50327416 CGCCGCTGGCCCCTGCGCGGTGG - Intergenic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203238469 22_KI270732v1_random:30916-30938 CGCCGCCGCCGCCGCCGGGGCGG + Intergenic
1203252222 22_KI270733v1_random:123936-123958 GGACGCCGGGCCCGGCCCGGCGG - Intergenic
1203253347 22_KI270733v1_random:128184-128206 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1203253481 22_KI270733v1_random:128538-128560 CGCCGCCGCCGACGCCGCGGCGG + Intergenic
1203261401 22_KI270733v1_random:173262-173284 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
950710585 3:14810647-14810669 GCCCGGCGGCCCCGCCCCGGAGG + Intergenic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
952816521 3:37452211-37452233 GCCCGCCGTCCGCGCCCCGGTGG + Exonic
953027561 3:39153687-39153709 GCCCGGCAGCCCCGCCCCGGAGG + Intronic
953947766 3:47163997-47164019 GGCCGCAGGTCCGACCGCGGCGG + Intergenic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
954912703 3:54122406-54122428 GCCGCCCGGCCCCGCCTCGGCGG - Intergenic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956675041 3:71725331-71725353 GGCCGCCGCGCCCCCCGCCGGGG - Exonic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
961202578 3:125056163-125056185 CGCCTCCGGGCCCGCCGCGCGGG - Intergenic
963904470 3:150762693-150762715 GTCCGCGGTGCCCGCCGCGGCGG - Exonic
963939492 3:151085544-151085566 GCCCGCGGGCCCCGGCGCCGAGG - Intergenic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
966362931 3:179148914-179148936 GGCCGCCGCCCCGGCCGCGGTGG + Intronic
966411836 3:179653094-179653116 GGCAGCCGGCCGAGCCGGGGCGG - Exonic
966594201 3:181711781-181711803 CGCCGCCGGCCGCGCGGGGGAGG - Intergenic
966911423 3:184562258-184562280 CGCCGCCGTCGCCGCCGCCGGGG + Exonic
967859669 3:194141514-194141536 GGCAGCCTGCCAGGCCGCGGGGG + Intergenic
968616555 4:1580249-1580271 GGCCGCCGAACCAACCGCGGAGG + Intergenic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968701373 4:2059639-2059661 GGCGGCCGGCCCGGGCGCGGCGG - Exonic
969344698 4:6563520-6563542 GGCGCCCGGCCCCGCCGCTCCGG - Intronic
969393987 4:6909296-6909318 GAGCTCAGGCCCCGCCGCGGTGG - Intronic
970332792 4:15002877-15002899 GGCTGCCCGCGCCGCCGCCGAGG - Exonic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
973293163 4:48490142-48490164 GGCCCGCGTCCCCGCCGAGGGGG - Intergenic
974047279 4:56908365-56908387 GGCCGCCAGCCCCCGCCCGGCGG - Intronic
976595581 4:86892252-86892274 GGCCGCCGGCGCCGGCTCGCGGG - Intronic
976600712 4:86935286-86935308 GGCCCCCGACGCCGCCGCCGCGG + Intronic
976765500 4:88593211-88593233 CGCCCCCGGCCCCGCCCAGGAGG - Intronic
978741835 4:112145695-112145717 GGCCGCTGTCCGCGCCGCCGCGG - Exonic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
979547125 4:121951428-121951450 GGCCGCGGCCCGCGCCTCGGAGG - Intronic
982198416 4:152937405-152937427 GGGCGCCAGCCCCTCTGCGGGGG - Intronic
984206459 4:176792757-176792779 GGCCGCGGGCGCTGCGGCGGGGG + Intergenic
984966392 4:185143615-185143637 GCCCGCCCGCCCGCCCGCGGGGG + Intronic
985629852 5:1008744-1008766 GGCCGCCGGGGGCGCTGCGGGGG + Intergenic
985696698 5:1344954-1344976 CGCCACCGCCACCGCCGCGGGGG + Exonic
986152482 5:5140273-5140295 TCCCGCCGCCCCCGCCGCCGCGG + Intergenic
986402839 5:7396191-7396213 GGCAGCCGGGCCGGCCGAGGCGG + Exonic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
987050469 5:14143764-14143786 GTCCTCCGGCCCCGCCGCGGCGG + Exonic
988595300 5:32585521-32585543 AGACGCCGGCCCCGCCGCGCTGG - Exonic
989229991 5:39074479-39074501 CGCCGCCGTCGCCGCCGAGGGGG - Intergenic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
990955154 5:61332814-61332836 GGCCCCGGCCCCCGCGGCGGCGG - Exonic
992042431 5:72848697-72848719 GGCCGGGGGCGCCGCCGCGTGGG + Intronic
992104206 5:73436818-73436840 GGCCGCGGGGCCCGGCGGGGCGG - Intergenic
992940033 5:81751827-81751849 GGCCCTCGGCGCCGCTGCGGTGG + Intergenic
994083320 5:95731535-95731557 CTGCGTCGGCCCCGCCGCGGTGG + Exonic
997302078 5:132813630-132813652 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
997476870 5:134147686-134147708 GGCTGCCGGGCCAGGCGCGGTGG + Exonic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
998119158 5:139561747-139561769 CGCCCCCGTCCCCGCCCCGGGGG + Exonic
998203901 5:140145910-140145932 AGCCGCAGCCGCCGCCGCGGCGG - Intergenic
1001070286 5:168579508-168579530 GGCCGCCGGCCTCGCCGCTCCGG + Exonic
1001382170 5:171312004-171312026 GGCAGCCGACCCGGCCGCTGGGG + Exonic
1001653189 5:173329566-173329588 TGTCCCCGGCCCCGGCGCGGGGG - Intergenic
1002082082 5:176743293-176743315 GGCCGTCGTCCCTGCCCCGGGGG + Intergenic
1002082177 5:176743606-176743628 GGCCGCCGGCCGGGCTGGGGCGG - Intergenic
1002160660 5:177312286-177312308 GGCCGGAGGCCCCGCCCCCGCGG - Exonic
1002487734 5:179550928-179550950 GGCCGCCGGCGCGGGCGCGGTGG + Intronic
1002591074 5:180291981-180292003 CGCCGCCGCCGCCGCCGCAGTGG + Exonic
1003206947 6:4021387-4021409 AGCCGCCGCCACCGCCGCCGAGG + Exonic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1003897024 6:10617279-10617301 GCCGGCCGGCCCCGCCGCCCGGG - Intronic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004864281 6:19837873-19837895 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1005288994 6:24359997-24360019 GGGCGCCGGCCGCGCGGGGGCGG + Intergenic
1005303777 6:24495065-24495087 GGCCGCCGGCGCGGGGGCGGAGG - Exonic
1005473926 6:26188949-26188971 CGCCGCCTGGCTCGCCGCGGCGG - Exonic
1006302352 6:33200321-33200343 CGCCGCCGCCGCCGCCGCTGCGG + Exonic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1007038835 6:38702868-38702890 GGCCGGCGGACCTGCAGCGGCGG + Intronic
1007521389 6:42453363-42453385 CGCCCCCGCCCGCGCCGCGGAGG - Intergenic
1007784260 6:44270959-44270981 GGGCGCCGGCCGCGCTGCGGCGG - Intronic
1007902039 6:45422010-45422032 GGCCGCCGCTCCCCCCGCGCGGG - Intronic
1011470340 6:87701858-87701880 GGCCACTGCCCCTGCCGCGGAGG - Exonic
1013507598 6:110815348-110815370 AGCCGCCGCCGCCGTCGCGGAGG - Intronic
1013575803 6:111482958-111482980 GGGCGCCGCCGCCGCTGCGGAGG - Exonic
1013619373 6:111873135-111873157 GGCCGCCGCCCGCGCCAGGGAGG - Exonic
1013793701 6:113860467-113860489 GGCCGCGGGCTCCTCCGCGGGGG - Exonic
1015880785 6:137867989-137868011 GGCCGCCAGCCCGGCGGAGGTGG + Intronic
1016329871 6:142945118-142945140 GGCCGCCGCAGCCGCAGCGGTGG + Exonic
1016923215 6:149317064-149317086 GGCGGCCGGCGGCGCCGCGCGGG - Intronic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017671984 6:156777763-156777785 GGGCGCCGGCCGCGGCCCGGGGG - Intergenic
1017672072 6:156778048-156778070 TGCCGCCGCTGCCGCCGCGGAGG - Exonic
1017672364 6:156779108-156779130 GGCCGCCGGCTCGGCGGCGGGGG + Exonic
1018400259 6:163414424-163414446 CGTCGCCCGCCCCGCCGGGGAGG + Intronic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1020204669 7:6105247-6105269 GGCCGCCGCCCCCTCCCCAGCGG - Intronic
1020831776 7:13102922-13102944 GGCCGCCCGCCCCGTCCAGGAGG + Intergenic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1022008918 7:26292126-26292148 GGCCGCCGTCCCCACCTGGGCGG - Exonic
1022100661 7:27167139-27167161 GGCCGCCAGCCTCGCCGCCAGGG - Intronic
1022103806 7:27184599-27184621 AGCCGCCGCCGCCGCCGCGGAGG + Exonic
1022106198 7:27199640-27199662 GCCCGCCGGGCCCGCCGGGCCGG + Exonic
1022427948 7:30285537-30285559 CGCCTCCGGCGGCGCCGCGGCGG + Exonic
1023638421 7:42236486-42236508 GGCGGCGGCCCCCGCGGCGGAGG + Intronic
1024499820 7:50093151-50093173 CGCCGCCTGCCCCGCCGCGCTGG + Exonic
1024741766 7:52362749-52362771 GCCAGCCGGCCCCGCCGCCCAGG + Intergenic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1027001606 7:74658095-74658117 GCCCCCCGCCCCCGCCTCGGGGG + Intronic
1027228601 7:76260043-76260065 GCCCCCCACCCCCGCCGCGGCGG - Intronic
1027421206 7:78019644-78019666 GGCCGGCAGGCCCGCCTCGGAGG - Exonic
1029098394 7:98107185-98107207 GGCCGCCGGCGTTGCGGCGGAGG + Exonic
1029456218 7:100673843-100673865 CGCCGCCGCCTCCGCCGCGGAGG + Exonic
1029640258 7:101815903-101815925 GGCCGCCGCCGCCGCCACCGAGG - Intronic
1029736743 7:102469452-102469474 GCCCGCCCTCCCCGCCTCGGAGG + Intronic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1031052058 7:116954146-116954168 GCCCTCCCGCCCGGCCGCGGAGG + Intronic
1031317371 7:120273813-120273835 GGCAGCCGCCGCCGCCGTGGCGG - Exonic
1031604145 7:123748696-123748718 AGCAGCCGCCGCCGCCGCGGAGG - Exonic
1032074497 7:128830172-128830194 GGCCCCCGGTGCCGCCGCGCTGG - Intergenic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1032174359 7:129611698-129611720 TGCCGCCGCCGCCGCCGCCGAGG - Exonic
1033033149 7:137846557-137846579 GGCAGCGGCCCCCGCCGCCGCGG + Exonic
1033477212 7:141702260-141702282 TGCCCGGGGCCCCGCCGCGGAGG + Intergenic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034347648 7:150397197-150397219 TGCAGCCGGGGCCGCCGCGGGGG + Exonic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034951295 7:155298359-155298381 GGCCGCCAGCCCCGCGGCGCTGG - Exonic
1035169538 7:157009945-157009967 CGCCGCCGCCGCCGCCGCTGGGG - Exonic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1036789498 8:11708666-11708688 GGCCGCCGCCGCCGCTGCCGCGG + Exonic
1036801358 8:11794901-11794923 GGCGGCCGGCCCCGCCGGCCAGG + Intergenic
1037535224 8:19817434-19817456 CGCCGCCGCCGCCACCGCGGGGG - Exonic
1037807405 8:22066410-22066432 GGCCGCAGGCCGGGCCGGGGCGG + Intronic
1038540369 8:28385907-28385929 GGCCGCCGGCCCGACAGCCGCGG + Intronic
1038540428 8:28386109-28386131 GGCCGCGGGCCGCGCCGGGAGGG - Intronic
1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG + Intronic
1038883617 8:31640112-31640134 GGCCGCCGCCCCCGGCGCCAGGG - Intronic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689761 8:60678232-60678254 CGCCGCCGGCCGCGCAGCGTCGG + Intergenic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041690080 8:60679350-60679372 GTCCGCCGGGCCGGCGGCGGCGG + Intronic
1042040199 8:64581354-64581376 GGACGCTGGCGCCGCCGTGGAGG - Exonic
1042532870 8:69833010-69833032 GGCCGCGGGCCCAGCGGCGGCGG - Exonic
1044719849 8:95134294-95134316 GGACGCCGCCGCCGCCGCGGGGG + Intronic
1045222577 8:100213258-100213280 GCCCGCCGCCGCCGCCGCAGAGG - Exonic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1047961712 8:130016210-130016232 GGCCGCCGGGCCGGGCGCTGCGG - Intronic
1049109793 8:140635640-140635662 GCCCGCCGCCCCGGCCGCGTCGG - Intergenic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049218420 8:141418061-141418083 GGACCCCAGCCCCGCCGGGGAGG + Intronic
1049409175 8:142464843-142464865 GGCCGCCCGCCTCGCCGCCCAGG - Exonic
1049554704 8:143276035-143276057 GCCCGCCGGCCGCTCCGCGCTGG - Exonic
1049688753 8:143949742-143949764 GGCCGCCTCCCTTGCCGCGGGGG - Intronic
1049752488 8:144291766-144291788 GCCCGTGGGCCCCGGCGCGGCGG + Exonic
1049782640 8:144435878-144435900 AGCCGCCGGCCCCGCCCCCGGGG - Exonic
1049784568 8:144444301-144444323 GGCCCCGGACCCCGCCGCGGAGG - Intronic
1049788487 8:144462531-144462553 GGCCGCCGGGCAGGCGGCGGCGG - Intronic
1051287408 9:15510824-15510846 GGCCGCGGGCGCCGACGCTGCGG + Exonic
1052048518 9:23821647-23821669 GGCCGTCAGCACTGCCGCGGAGG + Intronic
1052192792 9:25678180-25678202 CGCCGCCGCCGCCGCCGCTGGGG + Exonic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1053239862 9:36487207-36487229 GGCGCCCGGCCCCGCCGACGGGG - Intronic
1053306216 9:36986353-36986375 CCCCGCCGGCGCGGCCGCGGCGG - Intronic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514227 9:77020407-77020429 GGCCGCCGCCGCTGCCGCCGCGG + Exonic
1056475396 9:86947234-86947256 CGCCGCCGCCACCGCCGCCGCGG + Intergenic
1057361150 9:94374761-94374783 GGACGACGGCGACGCCGCGGAGG - Exonic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057489152 9:95508378-95508400 AGCCTCCGTCCCCGCGGCGGCGG - Exonic
1057600046 9:96450119-96450141 GGACGGCGGCGGCGCCGCGGGGG + Intergenic
1057662211 9:97013403-97013425 GGACGACGGCGACGCCGCGGAGG + Exonic
1057773164 9:97984467-97984489 GGCCCCGGGCGCCGCCGCCGCGG - Intronic
1058053249 9:100427139-100427161 GTCCGTCGGCGCCGCCGAGGAGG - Intronic
1058467564 9:105244659-105244681 AGCCGCCGTCGCCGCCGCCGGGG + Exonic
1058508851 9:105694551-105694573 GGCCGCCCGCTCCTCCGCGCCGG - Exonic
1059102194 9:111482817-111482839 GGCCGCCCCGCCCGCCGCCGGGG - Intronic
1060200943 9:121651569-121651591 AGCAGCCGGCCCCGCGGCGGGGG - Intronic
1060283476 9:122228849-122228871 AGGCGCCGGCCCCGCCGCCCCGG + Intronic
1060389799 9:123268217-123268239 GGCCGCCGCCGCCGCCGCTGCGG - Intronic
1060555382 9:124504986-124505008 GGCCCCCGGCCCCGGCGCGGCGG - Intronic
1060700474 9:125746546-125746568 CGCCGCCGGCACCGCCCCCGGGG - Intergenic
1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG + Exonic
1061415666 9:130445576-130445598 GGCCGCCAGCCCCACCGGGGAGG - Intronic
1061559680 9:131394354-131394376 GGCCCCCGGGCCCCCGGCGGCGG - Intronic
1061710217 9:132482309-132482331 GGCTGCCGGCCCGGCCTCGGTGG + Exonic
1061987089 9:134136170-134136192 AGCGCCCGGCCCCGCCGCCGCGG + Exonic
1062389288 9:136327639-136327661 GGCGGACGGCCACGGCGCGGGGG + Exonic
1062472458 9:136712494-136712516 GGCCGACGGCGGCGCGGCGGGGG - Intergenic
1062527188 9:136982713-136982735 GGCATCCGGCCCCACCCCGGAGG + Intronic
1062621088 9:137422974-137422996 GGCCGCCGGCTCTCCCGGGGTGG - Intronic
1062696345 9:137877996-137878018 CCCCGCCGGCCCCGCCGCCCCGG - Exonic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1202800338 9_KI270719v1_random:169980-170002 GACCGCCGGCGCAGGCGCGGAGG + Intergenic
1203773676 EBV:61499-61521 CGCCGCCGCCCCCGCCGCGACGG - Intergenic
1203469747 Un_GL000220v1:111331-111353 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477568 Un_GL000220v1:155303-155325 GTCGTCCGGCCCCGCCGCGCCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1185505359 X:629683-629705 GTCCCCAGGCCCCGCCGGGGAGG + Intronic
1185892792 X:3835584-3835606 GGCCGCCGCATCCGCCGCGGCGG + Intronic
1185897900 X:3874004-3874026 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1186611155 X:11139363-11139385 GGCCGCAGCCCCCGCGACGGAGG - Exonic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1187464410 X:19515027-19515049 GGCCGCCGGCCGCGCCGCCCTGG + Exonic
1187826177 X:23334757-23334779 CGCCGCCGTCGCCGCCGCCGCGG + Exonic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1196016355 X:110944462-110944484 GGCCGCCGCCACCACCGCTGCGG + Intronic
1197754304 X:129983707-129983729 GGCCGCCGGGCCGGGCGCGGCGG + Intronic
1198807225 X:140504334-140504356 GGCCGCCGCCGCCGCTGCCGCGG - Exonic
1200092489 X:153642449-153642471 AGCCGCCGCCGCCGCTGCGGAGG - Intergenic
1200092490 X:153642452-153642474 GGCAGCCGCCGCCGCCGCTGCGG - Intergenic
1200100951 X:153688893-153688915 GACCCCCGGAGCCGCCGCGGAGG + Intronic
1200115354 X:153767571-153767593 GGGCCCGGGCCCCGCGGCGGCGG - Exonic
1200128765 X:153830212-153830234 GGCCGCCGGCGCTGCGGCGGGGG - Intronic
1200209698 X:154341759-154341781 GGCCGACGCCCCGGCAGCGGCGG + Intergenic
1200216868 X:154371842-154371864 GTCCGCCGGCCCGGCAGCGGCGG + Intronic
1200221154 X:154390333-154390355 GGCCGACGCCCCGGCAGCGGCGG - Intronic