ID: 1153913179

View in Genome Browser
Species Human (GRCh38)
Location 18:9721798-9721820
Sequence CGGTGCACAAATACCGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 25}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153913173_1153913179 12 Left 1153913173 18:9721763-9721785 CCTCATGGAGCTGATATTCTAGT 0: 2
1: 24
2: 216
3: 750
4: 1997
Right 1153913179 18:9721798-9721820 CGGTGCACAAATACCGAGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 25
1153913172_1153913179 17 Left 1153913172 18:9721758-9721780 CCTGACCTCATGGAGCTGATATT 0: 2
1: 7
2: 69
3: 390
4: 1413
Right 1153913179 18:9721798-9721820 CGGTGCACAAATACCGAGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 25
1153913171_1153913179 18 Left 1153913171 18:9721757-9721779 CCCTGACCTCATGGAGCTGATAT 0: 2
1: 5
2: 53
3: 377
4: 1330
Right 1153913179 18:9721798-9721820 CGGTGCACAAATACCGAGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153913179 Original CRISPR CGGTGCACAAATACCGAGTG TGG Intronic
901494194 1:9612073-9612095 CGGGGCCCAAATCCCGAGAGGGG - Intronic
912470074 1:109900810-109900832 CCCTGCACAAATACTGAGTGAGG - Intergenic
916446055 1:164872758-164872780 AGCTGCACAAATGCCCAGTGGGG - Intronic
923511197 1:234655433-234655455 CTGTGCATAATTACTGAGTGGGG - Intergenic
1067064245 10:43094697-43094719 CGGTGCACACATACTAAGCGTGG - Intronic
1072246291 10:93547146-93547168 CGGTGCACAAAGGCCGGGCGTGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1121792819 14:96711781-96711803 GGGAGCACACATACCGAGTTAGG + Intergenic
1148813170 17:50307768-50307790 AGGTGCACAAATACAAAGTCAGG + Intergenic
1152976003 18:218975-218997 CGGTACAAAAATAACCAGTGAGG + Intronic
1153913179 18:9721798-9721820 CGGTGCACAAATACCGAGTGTGG + Intronic
946900162 2:224364558-224364580 AGTTGCACAAAGACCCAGTGAGG - Intergenic
1169754659 20:9031144-9031166 TGGTGCACAAAGAAAGAGTGTGG + Intergenic
1172147884 20:32769554-32769576 CTGTCCACAATTACCTAGTGGGG - Intronic
1179959175 21:44758740-44758762 CGGTCCACACACACTGAGTGTGG + Intergenic
954816995 3:53290382-53290404 CCATTCACAAATACCGAGTAAGG + Intronic
961648750 3:128407106-128407128 CGGTGCACAAAGGCAGAGAGTGG + Intronic
972589797 4:40473974-40473996 CAGTGCACAAAGACGGAGTGGGG - Intronic
978557180 4:109993294-109993316 AGCTGCACAAATACAGAGGGAGG + Exonic
997446070 5:133941343-133941365 CACTGCACACATACCCAGTGTGG - Intergenic
1001885903 5:175289996-175290018 CGTTGCACAAAAACTGAGTTAGG + Intergenic
1003484086 6:6560472-6560494 CGGTGCAAAGATACAGGGTGGGG - Intergenic
1010627178 6:78152740-78152762 CGGTGCACAAAGACCCACTGGGG + Intergenic
1014230948 6:118901491-118901513 CTCTTCACAAATACCTAGTGGGG - Intronic
1017815991 6:158017057-158017079 CGGCCCACAAACACCAAGTGTGG - Intronic
1026079574 7:67205656-67205678 CGGTCAGCAAATACTGAGTGGGG - Intronic
1036047065 8:5155187-5155209 CAGTGCACATATAAGGAGTGGGG - Intergenic
1054782121 9:69174789-69174811 CTTTGCATCAATACCGAGTGTGG - Intronic
1062158181 9:135065668-135065690 CGTTGCACAAAGACAGAGAGAGG - Intergenic