ID: 1153914167

View in Genome Browser
Species Human (GRCh38)
Location 18:9731352-9731374
Sequence TATTACCTCTACCAGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153914162_1153914167 26 Left 1153914162 18:9731303-9731325 CCCTTGGTCTTTTCTTCCATTTT 0: 1
1: 0
2: 9
3: 149
4: 1433
Right 1153914167 18:9731352-9731374 TATTACCTCTACCAGGTGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 97
1153914163_1153914167 25 Left 1153914163 18:9731304-9731326 CCTTGGTCTTTTCTTCCATTTTG 0: 1
1: 1
2: 12
3: 117
4: 795
Right 1153914167 18:9731352-9731374 TATTACCTCTACCAGGTGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 97
1153914165_1153914167 10 Left 1153914165 18:9731319-9731341 CCATTTTGCTGTTTTTTTGGACA 0: 1
1: 0
2: 3
3: 66
4: 990
Right 1153914167 18:9731352-9731374 TATTACCTCTACCAGGTGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153914167 Original CRISPR TATTACCTCTACCAGGTGCT TGG Intronic
902852437 1:19170774-19170796 TATTGGCTCTAGCAGGTGCAAGG - Exonic
904472074 1:30742196-30742218 TATCACCTTTACCAGCTGGTGGG + Intronic
907990429 1:59577135-59577157 TACTGACTGTACCAGGTGCTGGG - Intronic
908411705 1:63872481-63872503 TATCACCTCTACTAAGTGTTTGG - Intronic
909127634 1:71694564-71694586 AATTACCTCAACAAAGTGCTAGG + Intronic
909537586 1:76755455-76755477 TATAACCTTTACCACGTGCAAGG + Intergenic
909738854 1:79002639-79002661 TATTAGCTCTACCACTTGTTTGG - Intronic
912255832 1:108057203-108057225 GCTTACTTTTACCAGGTGCTTGG + Intergenic
912684754 1:111753713-111753735 TATTGGGTCTACCAGGTGCTTGG + Intronic
913348051 1:117827734-117827756 TTGTATCTCTAACAGGTGCTAGG + Intergenic
916420224 1:164630755-164630777 CATTGCCCCTACCAGGTACTTGG + Intronic
916982848 1:170157161-170157183 TATACCCTTTACCAAGTGCTAGG + Intronic
919945304 1:202314933-202314955 TAATACCTCAACTAGGTGGTTGG - Intronic
921123945 1:212160515-212160537 TATTTATTCTACCAAGTGCTTGG - Intergenic
922540958 1:226419139-226419161 TAGTACCTGTGCCAGGTACTAGG - Intergenic
924614046 1:245598144-245598166 TTTTACCCCTACAAGGTTCTAGG - Intronic
1063100780 10:2947934-2947956 TATTACATCTACCATGTGGTAGG - Intergenic
1068556107 10:58460737-58460759 TATTACCTTTGCCGAGTGCTAGG + Intergenic
1073322515 10:102624080-102624102 CAGTACCTCCACCATGTGCTAGG - Intronic
1073831521 10:107389137-107389159 TCTTGCCTATACCAGGTCCTAGG + Intergenic
1073904440 10:108261603-108261625 TATCATCTATAGCAGGTGCTTGG - Intergenic
1075899069 10:126023814-126023836 TTTTGCCTCTGCCAGGTGCCTGG - Intronic
1078939695 11:15988770-15988792 TATTATATCCACCAGGTGCCAGG - Intronic
1081794856 11:45812119-45812141 TGTTACCTGGGCCAGGTGCTGGG - Exonic
1086260025 11:84928462-84928484 TATTACATTTACCATGTTCTAGG - Intronic
1087594671 11:100237538-100237560 CATTACCTTTGCCAGGTGTTTGG - Intronic
1088430623 11:109754600-109754622 TTTTCCCTCCACCAGATGCTTGG - Intergenic
1089895588 11:121927351-121927373 CATTATCTCTTCCAGGTGCCAGG + Intergenic
1098923833 12:76327701-76327723 TCTTACCTCTCCCAGCTTCTGGG - Intergenic
1103490514 12:121315090-121315112 TATTACCTGTAACAGGTTTTGGG - Intronic
1104645163 12:130492186-130492208 CATTCCTTCTGCCAGGTGCTGGG - Intronic
1107352126 13:39526202-39526224 TAATCCCTGTACCAGGGGCTTGG - Intronic
1110468621 13:75831788-75831810 TGTTACCTTTAACAGGTGTTTGG - Intronic
1119047551 14:71333202-71333224 TGTTACCTCTTCTAGGTGCTTGG + Intronic
1122735439 14:103837087-103837109 TATAAACTCTGCCAGGTGCCTGG + Intronic
1124177031 15:27435950-27435972 TGTTACCAGTACCAGGTGATGGG + Intronic
1132223385 15:100122244-100122266 TATTAGCTATAACAGGTGGTTGG - Intronic
1134219428 16:12342027-12342049 TTTTACCTCTCCCAGATTCTGGG + Intronic
1134798898 16:17066448-17066470 GGTTACCTCCACCTGGTGCTTGG + Intergenic
1135428734 16:22363560-22363582 TATTTCCTGAACCAGGTGCTGGG - Intronic
1135581913 16:23635009-23635031 TGTATCTTCTACCAGGTGCTTGG + Exonic
1141127421 16:81410736-81410758 TACAACCTCGAGCAGGTGCTCGG - Intergenic
1142860406 17:2757410-2757432 GATTACCTCTGCCAGGGGCACGG - Intergenic
1145958184 17:28869438-28869460 TATTACCTGTACCTGGAGCCAGG - Intergenic
1153914167 18:9731352-9731374 TATTACCTCTACCAGGTGCTTGG + Intronic
1155110048 18:22705818-22705840 TATTACATCTACCATGTGTCAGG + Intergenic
1155156098 18:23158915-23158937 TAGCATCTCTACCAGATGCTAGG - Intronic
1158250600 18:55483089-55483111 TATTGCCCCTACCCCGTGCTGGG - Intronic
1160238985 18:77109109-77109131 TCTTACCTCCACCAGGTCCAGGG + Intronic
1165290019 19:34875521-34875543 TTTTACATCTACCAAGTGCTGGG + Intergenic
925950340 2:8903589-8903611 TATTATCTCTACCTGGGGCAAGG + Intronic
933036445 2:77405336-77405358 TCTTGCCTCTACCATGTTCTGGG - Intronic
935525072 2:104155719-104155741 TCTTTCCTCTACTAGGTTCTGGG + Intergenic
941993625 2:171580606-171580628 TATTTCATCACCCAGGTGCTAGG + Intergenic
942499737 2:176576774-176576796 TATTGCCTCCACCAGCTGCACGG - Intergenic
943526735 2:189025771-189025793 GATTTCCTGTACCATGTGCTGGG + Intergenic
945730561 2:213527288-213527310 TGTTACCCCTACAAGCTGCTTGG + Intronic
1172004449 20:31809116-31809138 TCTTAACTCTACCAGGAGGTTGG + Intergenic
1172155897 20:32824225-32824247 TACTAGCTCTACCGCGTGCTAGG - Intronic
1174900490 20:54494478-54494500 CATTCCTTCTACCAGCTGCTTGG + Intronic
949646127 3:6096358-6096380 AATAATCTCTACCATGTGCTAGG - Intergenic
954876200 3:53804647-53804669 CCTTCCCTCTGCCAGGTGCTGGG - Intronic
954977477 3:54709948-54709970 TAATACCTCTACCAGGTGGTAGG - Intronic
959290925 3:104472934-104472956 TATTACCTCTAACAGTTTTTGGG - Intergenic
962669452 3:137690103-137690125 TATTAACTCTCCCAGGTAATGGG - Intergenic
964579043 3:158209994-158210016 TATTCCCTCTACCTAGTGATTGG + Intronic
969576087 4:8036542-8036564 TTTCACCTATACCAGGAGCTGGG - Intronic
970325704 4:14921003-14921025 CATCACCTCTGCCAGGTGTTTGG + Intergenic
970919961 4:21382476-21382498 TATTAACTCTACTGGATGCTTGG - Intronic
972637928 4:40900865-40900887 TATGACACCTACCATGTGCTAGG + Intronic
976123031 4:81803833-81803855 AATTTCCTCTACCAGCTGATTGG + Intronic
984519161 4:180780082-180780104 TATTAGCTCTAGCAGGTTTTTGG + Intergenic
987984311 5:25126100-25126122 TATCACTTGTACCAGTTGCTTGG + Intergenic
991013416 5:61907598-61907620 TATTACCTTTAACAAGTTCTTGG - Intergenic
991031362 5:62085465-62085487 TATTACCTCTATGAGATGGTAGG - Intergenic
997079770 5:130724416-130724438 GATTTCCTTTCCCAGGTGCTTGG - Intergenic
998189967 5:140015286-140015308 TAAAACTTCTTCCAGGTGCTTGG - Intronic
998734309 5:145118021-145118043 TATTCTTTCTTCCAGGTGCTGGG - Intergenic
1000136894 5:158361707-158361729 TGTGTCCTCTACCAGGTGTTAGG + Intergenic
1004514606 6:16311889-16311911 CATTACCTCTGCCTGGTGTTGGG - Intronic
1004744726 6:18498494-18498516 CATGACCTCTACCAGGTGAGAGG - Intergenic
1008815851 6:55565195-55565217 CAGTACCTCTACCAGGTGAGTGG + Intronic
1011080684 6:83487297-83487319 CATTACCTCTAGCAAGTCCTAGG + Intergenic
1012123763 6:95400231-95400253 TATTCCCTCTCCCAGCTCCTAGG - Intergenic
1015800089 6:137051948-137051970 TATTAGCACTCCCAGGAGCTTGG - Intergenic
1015835619 6:137417185-137417207 TGCTACCTCTACCAGCTGCAAGG + Intergenic
1020789541 7:12609585-12609607 TTTTATATCTACCAGATGCTGGG - Intronic
1024639751 7:51318972-51318994 TGCTGCCTCTGCCAGGTGCTTGG - Intergenic
1027399529 7:77793151-77793173 TATTACCTCTACCTTCTGGTTGG - Intergenic
1031121153 7:117724078-117724100 TATGACGTGTACCATGTGCTGGG - Intronic
1032482153 7:132255879-132255901 TCTTAACTTTTCCAGGTGCTGGG - Intronic
1034571766 7:151961694-151961716 GATTACCTTTTCCAGGTGCAGGG + Intronic
1037609769 8:20466284-20466306 TATTGCCTCCATCTGGTGCTGGG + Intergenic
1038678324 8:29643808-29643830 TATTTCATCTATCCGGTGCTGGG - Intergenic
1040039626 8:42903132-42903154 TTGCACCTCTACCAGGTGTTTGG + Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045548042 8:103145747-103145769 TAGTCACTGTACCAGGTGCTGGG - Intronic
1056453607 9:86739707-86739729 TATTAGCTCTACTCAGTGCTAGG + Intergenic
1058917005 9:109577112-109577134 TAGTACCTGTACTAAGTGCTGGG + Intergenic
1060297631 9:122353971-122353993 TCTTCCCTGTTCCAGGTGCTCGG + Intergenic
1185724034 X:2405070-2405092 TATTACCTCTGCCAAGGGCTGGG - Intronic
1192091247 X:68158736-68158758 TTTTCCCTCTAGCAGGTGATTGG + Intronic
1192744677 X:73927213-73927235 TATTAGCTCTAACAGGTCTTTGG + Intergenic
1193215637 X:78860842-78860864 TACTACCACCACCAGGTGTTTGG - Intergenic
1195935645 X:110123680-110123702 TATTACCTCTATCACTGGCTGGG + Intronic