ID: 1153914390

View in Genome Browser
Species Human (GRCh38)
Location 18:9732988-9733010
Sequence TGAGCTGAGCTTTCACCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153914390 Original CRISPR TGAGCTGAGCTTTCACCAGG TGG Intronic
900400518 1:2471143-2471165 TGAGCTGGGCTGCCACCAGCTGG + Intronic
901899863 1:12351474-12351496 AGAGATGAGGTTTCACCAGTTGG + Intronic
902326912 1:15706928-15706950 TGAACTGAGCTTTGAGCAAGAGG + Intronic
902403831 1:16172475-16172497 GGAGCAGAGCTGGCACCAGGAGG + Intergenic
902757167 1:18556563-18556585 TGAGCTGACATTCCAGCAGGGGG + Intergenic
903433483 1:23327789-23327811 GGGGCTGAGTTTTCACTAGGAGG + Intronic
903822918 1:26116899-26116921 AGAGATGAGATTTCACCATGTGG + Intronic
904647476 1:31978623-31978645 GGAGATGAGGTTTCACCATGTGG - Intergenic
904676171 1:32200614-32200636 CCAGCTTAGCTTTCACCCGGTGG + Exonic
906399320 1:45493308-45493330 TTATTTGAGCTGTCACCAGGTGG - Intergenic
906434469 1:45783655-45783677 TGAGCTGAGATTGCACCACTGGG - Intergenic
906607620 1:47182812-47182834 TGAGCTGAGCTTTCTCTCCGTGG - Intergenic
906937798 1:50229552-50229574 TGAGATGAGCTTCCACTAAGAGG - Intergenic
907662256 1:56404233-56404255 GGAGCTGAGGCTTCACCATGCGG - Intergenic
907675021 1:56510179-56510201 TGAGCTTTGCTCTCAGCAGGAGG - Intronic
908096309 1:60742666-60742688 TGAGCACAGGTTACACCAGGAGG - Intergenic
908828039 1:68152339-68152361 TTAGCTGTGCTTTCCCTAGGGGG - Intronic
909137782 1:71822909-71822931 TCAGCTATGCTTTCAGCAGGCGG - Intronic
910376018 1:86571575-86571597 TGAGCTGGGCTTTGAACAGGTGG + Intronic
910673971 1:89799234-89799256 TGAGCTGTGAGTTGACCAGGAGG + Intronic
910838756 1:91541517-91541539 TGAGCTGAGATTTCAGGAGCAGG + Intergenic
914429153 1:147604202-147604224 ACATCTGAGCTTTCCCCAGGAGG + Intronic
917455664 1:175183566-175183588 TGGGCTGAGCTTTCACAATTGGG + Intronic
921555029 1:216588096-216588118 TTAGTTGAGCATCCACCAGGGGG - Intronic
921877168 1:220210777-220210799 TGAGTTGAGTTTTCAACAGCTGG - Intronic
922171779 1:223161716-223161738 TGTGCTGAGCTTACATCTGGAGG - Intergenic
923114556 1:230922816-230922838 TGCTGTGAGCTTTCAGCAGGTGG + Intronic
924446336 1:244135890-244135912 GGATTTGTGCTTTCACCAGGAGG + Intergenic
1063032316 10:2247833-2247855 TGAGCTGAGGTTGCCCCTGGGGG - Intergenic
1064015188 10:11766082-11766104 TGAGCTGAGCTCTGCCCAGTAGG + Intergenic
1064611099 10:17103415-17103437 TCAGCTGAGCTTTGAACAAGAGG - Intronic
1064727655 10:18297726-18297748 TGAGATGAGCTTTCAGCTGGTGG + Intronic
1066448855 10:35509919-35509941 TGAGCTGGGAGTTCAGCAGGTGG + Intronic
1069470217 10:68681779-68681801 TGAGATGGGGTTTCACCATGTGG - Intronic
1069609078 10:69760410-69760432 TGAGCTGTGTGTTCACCAGTGGG - Intergenic
1070804210 10:79261237-79261259 TGAGCTGAGCGCGCACCAGTTGG - Intronic
1072161319 10:92769977-92769999 TGGGCTGGGCTTGGACCAGGTGG - Intergenic
1072344277 10:94488331-94488353 TGAGCTGAGATTGCACCACTGGG + Intronic
1075132282 10:119749953-119749975 AGAGATGAGGTTTCACCATGTGG + Intronic
1076102188 10:127791739-127791761 AGAGATGAGGTTTCACCACGTGG + Intergenic
1076267515 10:129120185-129120207 AGAGATGAGGTTTCACCATGTGG - Intergenic
1076576704 10:131474339-131474361 TGTGCTGAGTTTTCTCCAGCAGG + Intergenic
1077443878 11:2581284-2581306 TGGGCTGAGAGCTCACCAGGTGG + Intronic
1077629814 11:3803611-3803633 AGAGATGAGGTTTCACCATGTGG + Intronic
1078427295 11:11262109-11262131 TGAGCTGAGCTTTGTCCATGAGG + Intergenic
1081659720 11:44880576-44880598 TCAGCTGAGCTGTGATCAGGTGG - Intronic
1082798628 11:57396975-57396997 TCAGCTAAACTTTCTCCAGGGGG - Intronic
1083626492 11:64074613-64074635 TGAACTGGGCTTTCCCCAAGGGG + Intronic
1084340323 11:68494336-68494358 AGAGATGGGCTTTCACCATGTGG - Intronic
1087105140 11:94401025-94401047 TGAGCAGGGCTTTCACCGTGGGG + Exonic
1087625475 11:100590975-100590997 TGAACTCAGCTCTCATCAGGCGG - Intergenic
1088125466 11:106418511-106418533 AGAGATGGGCTTTCACCATGTGG - Intergenic
1090373687 11:126274460-126274482 AGAGATGAGGTTTCACCAGTTGG - Intronic
1094363043 12:29650709-29650731 TGATCTGAGCTTTCACAAACAGG + Intronic
1094736092 12:33235555-33235577 TGAGCTGTGTTTACTCCAGGGGG + Intergenic
1096747586 12:53738736-53738758 TGGGCGGGGCTTTCTCCAGGTGG + Intergenic
1098151044 12:67546976-67546998 TGAGCTGACCTTTGAGCAGAAGG - Intergenic
1102145945 12:110655284-110655306 TGAGCTCAGCAAGCACCAGGAGG + Exonic
1103557019 12:121772607-121772629 AGAGATGAGATTTCACCAGTTGG + Intronic
1104955499 12:132463279-132463301 TCAGCTATGCTTTCACAAGGAGG - Intergenic
1105208942 13:18246702-18246724 TGTGCTCACCTCTCACCAGGAGG - Intergenic
1105407622 13:20144993-20145015 AGAGATGAGGTTTCACCATGTGG - Intronic
1107093688 13:36512210-36512232 AGAGCTGTGCTTTCACATGGAGG + Intergenic
1107152817 13:37131625-37131647 TGAGCTGAGTTTTCATCTGGAGG - Intergenic
1108190915 13:47938277-47938299 TGAGCTGTGCTCTCATCAGGAGG + Intronic
1110181420 13:72622267-72622289 TGCACAGAGCTGTCACCAGGTGG - Intergenic
1110686974 13:78386886-78386908 CAAGCTGAGCTTTCAAGAGGAGG - Intergenic
1112343135 13:98568679-98568701 AGAGATGAGGTTTCACCATGTGG - Intronic
1113357078 13:109591154-109591176 TTATCTGAGCTTTCAGAAGGAGG + Intergenic
1116023531 14:39489008-39489030 TGAGTTTAGCTTTCCCAAGGTGG - Intergenic
1117045901 14:51813055-51813077 AGAGGTGAGGTTTCACCATGTGG - Intergenic
1117178106 14:53165757-53165779 AGAGATGAGGTTTCACCACGTGG + Intergenic
1117223951 14:53635838-53635860 TGAGCTGAGCCTTGACCAATGGG - Intergenic
1118902006 14:69993973-69993995 TGAGCCGAGATTGCTCCAGGTGG - Intronic
1119750811 14:77076132-77076154 TCAGCTGAGCTTTCAGCCAGGGG + Intergenic
1121324321 14:93011256-93011278 TTAGCTGGGCTTGCACCACGTGG - Intronic
1123625323 15:22223280-22223302 TGAGCTGAGTCGACACCAGGTGG + Intergenic
1124002880 15:25773397-25773419 TGAGCACAGCTTTCAACAAGAGG - Intronic
1124231334 15:27948518-27948540 TGAGCTGAGATTGCACCACTGGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126694609 15:51315310-51315332 TGAGCTAAGCATGCACCATGAGG - Intronic
1127372840 15:58356632-58356654 AGAGATGAGATTTCACCAGTTGG - Intronic
1128779578 15:70350241-70350263 TGGGCTGAGTGGTCACCAGGAGG + Intergenic
1132165401 15:99582685-99582707 TGAGCTGAGCTTTCGACATATGG + Intronic
1132171990 15:99667723-99667745 TCAGTTGAACTTCCACCAGGCGG + Intronic
1133118420 16:3591388-3591410 AGAGCAGAGTCTTCACCAGGAGG + Intronic
1133930808 16:10230630-10230652 TGAGCTGAGCCTTGACAGGGTGG + Intergenic
1136253622 16:29024033-29024055 TGGGATGAGGCTTCACCAGGCGG + Intergenic
1137855057 16:51786260-51786282 TGAGCGGAGATTGCACCTGGGGG - Intergenic
1138983840 16:62302749-62302771 TGAAGCAAGCTTTCACCAGGGGG + Intergenic
1140084463 16:71781934-71781956 TGGTATGAACTTTCACCAGGAGG + Intronic
1140474697 16:75234014-75234036 TGAGCTGAGTGGCCACCAGGTGG + Intronic
1141125298 16:81396886-81396908 TGAGCTGAGATTGCATCAGGAGG - Intergenic
1141155935 16:81597195-81597217 TCAGCAGAGCTGTCACAAGGTGG + Intronic
1141413574 16:83853162-83853184 TGAGCTGAGCTTGCCCCATGGGG - Intergenic
1142123800 16:88400290-88400312 TTTGCTGGGCTTTCAGCAGGTGG - Intergenic
1142509208 17:384119-384141 GGAGCTGAGCTTTGCCCAGGAGG + Intronic
1143011270 17:3867493-3867515 TGAGTTGAGCATTGACCAGGGGG + Intronic
1143503856 17:7353278-7353300 TGAGCTGAGCTCCGTCCAGGTGG + Exonic
1144661459 17:17073451-17073473 TTACCTGACCTTTCTCCAGGAGG - Intronic
1145878426 17:28336716-28336738 GGAGGTGAGCCCTCACCAGGAGG - Intronic
1145883580 17:28368353-28368375 AGAGCTGAGCTTTCCCCAAAAGG + Intronic
1146751925 17:35389626-35389648 GGGGCTGAGGGTTCACCAGGAGG + Intergenic
1148084720 17:44987293-44987315 TGAGCAGAGCTCTCTCCATGGGG + Intergenic
1149762121 17:59241740-59241762 AGAGATGAGGTTTCACCATGTGG - Intronic
1150348078 17:64420102-64420124 TGAACTGACCTTTAACCAGGAGG + Intergenic
1150928610 17:69560474-69560496 AGAGATGAGGTTTCACCATGTGG + Intergenic
1151255665 17:72874484-72874506 TGAGCAAAGCTGACACCAGGAGG + Intronic
1151803366 17:76390735-76390757 TGAAGCGAGCTTTCAACAGGCGG - Exonic
1152361809 17:79836327-79836349 GGAGCGCAGCGTTCACCAGGTGG - Intronic
1152768061 17:82151605-82151627 TGAGCTGCTCTTTCTCCAGGCGG + Intronic
1153312412 18:3690139-3690161 TGAGCTGTGATTGCACCAGAGGG - Intronic
1153914390 18:9732988-9733010 TGAGCTGAGCTTTCACCAGGTGG + Intronic
1153953704 18:10077967-10077989 GGAGCTGAAGCTTCACCAGGAGG - Intergenic
1155201325 18:23520339-23520361 TGTGCTGCCCTTTCACCATGTGG + Intronic
1155873292 18:31053690-31053712 TGGGCTGTGTTTTCATCAGGAGG + Intergenic
1157820416 18:50763679-50763701 TGAGCTGAGATTGCACCACTGGG + Intergenic
1158197285 18:54902601-54902623 TGAGTTGATCTTTCACCAGCTGG - Exonic
1160036036 18:75302594-75302616 TGAGCTGACCCTTGGCCAGGCGG + Intergenic
1160997243 19:1888428-1888450 TGCGTTTACCTTTCACCAGGTGG - Intergenic
1161215025 19:3090299-3090321 TGAGCCGAGATCACACCAGGAGG - Intergenic
1161885989 19:6996087-6996109 TGAGCTGAGCTCGCACCACTGGG - Intergenic
1162085715 19:8247917-8247939 AGAGATGAGGTTTCACCATGTGG + Intronic
1165244644 19:34491508-34491530 TGAGATGGGATTTCACCATGTGG + Intronic
1165347654 19:35258949-35258971 TGACCTGACCTTTGACCAGACGG + Exonic
1165703373 19:37955680-37955702 TGATATGAGCTATCACCTGGAGG - Intronic
1165761002 19:38321094-38321116 TGAGATGGGGTTTCTCCAGGGGG - Intronic
1167572887 19:50300866-50300888 TGAGCTGGGATTTCACCAGCTGG + Intronic
1167735763 19:51293742-51293764 TGAGCACAGCATTCACCACGGGG + Intergenic
1167817212 19:51893915-51893937 AGAGCTTACCTTTCACCTGGTGG - Intronic
1167903639 19:52640570-52640592 TGAGCTGAGATTGCACCACTGGG - Intronic
1167922158 19:52790864-52790886 AGAGATGAGGTTTCACCATGTGG + Intronic
1168333288 19:55581682-55581704 TGAGCTGAGCTCACACTGGGAGG + Intergenic
925314954 2:2914433-2914455 GGCGCTGAGCTTTCTCAAGGAGG + Intergenic
925985528 2:9212042-9212064 TGAATTCAGCATTCACCAGGGGG - Intronic
926193572 2:10746183-10746205 AGAGATGAGGTTTCACCATGTGG + Intronic
926676129 2:15621837-15621859 AGAGATGAGGTTTCACCATGTGG + Intronic
927179815 2:20436990-20437012 TCAGCTAAGCTATCAGCAGGTGG - Intergenic
927976743 2:27344207-27344229 AGAGATGAGGTTTCACCATGTGG + Intronic
932589955 2:73059288-73059310 TGAGCTCAGCTTTGCCCAGCTGG - Intronic
933556475 2:83836626-83836648 TGAGCTGAGATGGCGCCAGGAGG + Intergenic
936030575 2:109067424-109067446 TGTGCTGTACTTTCACCATGGGG + Intergenic
936449198 2:112620806-112620828 AGAGATGAGGTTTCACCATGTGG + Intergenic
938277260 2:130037732-130037754 GGTGCTGGGCTTTGACCAGGTGG - Intergenic
938361720 2:130692957-130692979 GGGGCTGGGCTTTGACCAGGCGG + Intergenic
938438125 2:131299640-131299662 GGTGCTGGGCTTTGACCAGGTGG + Intronic
938659867 2:133474994-133475016 AGAGCTGTGGTTTCACCATGCGG + Intronic
940044420 2:149393758-149393780 TGAGATTAGCTTTCCCCAGCTGG + Intronic
940759672 2:157723915-157723937 TGAGCTGAGCCTTCACTACCTGG - Intergenic
944231444 2:197397608-197397630 AGAGATGAGGTTTCACCATGTGG - Intronic
944450094 2:199833945-199833967 TGAGCAGAGCTCTCTCCATGTGG - Intronic
945263077 2:207862986-207863008 TGTGGTGAGGTTGCACCAGGAGG + Intronic
946614211 2:221491958-221491980 TGAGCTGAGATTGCACCACTGGG + Intronic
948681476 2:239638018-239638040 TGGGCTGAGTTTGCACCTGGTGG - Intergenic
948767504 2:240230843-240230865 TCAGCAGATCTTCCACCAGGGGG + Intergenic
948946209 2:241221259-241221281 AGAGATGAGGTTTCACCATGTGG + Intronic
1171026187 20:21632614-21632636 TGAGCTGGGCCTTGGCCAGGAGG + Intergenic
1171290118 20:23978434-23978456 TGTGCTCACCTCTCACCAGGAGG - Intergenic
1173816101 20:45989282-45989304 AGAGATGAGATTTCACCATGTGG - Intergenic
1173903380 20:46607401-46607423 AGTTCTGAGCTTTGACCAGGTGG - Intronic
1175328262 20:58144738-58144760 TGTGCTGAGCACTCTCCAGGTGG + Intergenic
1175916384 20:62427934-62427956 TGAGCTGAGCTGTGAACAGCAGG - Intergenic
1178746806 21:35259581-35259603 TAATCTGAGCTTTAACTAGGAGG + Intronic
1179054354 21:37916985-37917007 TGAGCTTTGCTTGCACCTGGTGG + Intergenic
1179167136 21:38944100-38944122 CCAGCTGGGCTTTCATCAGGAGG - Intergenic
1179499980 21:41802371-41802393 AGGGCTGAGCTTTCACCATAAGG + Intronic
1180023280 21:45142854-45142876 GGAGCAGGGCTTTGACCAGGGGG + Intronic
1180767316 22:18352596-18352618 TGTGCTCACCTCTCACCAGGAGG + Intergenic
1180778993 22:18509783-18509805 TGTGCTCACCTCTCACCAGGAGG - Intergenic
1180811714 22:18767103-18767125 TGTGCTCACCTCTCACCAGGAGG - Intergenic
1181197867 22:21201345-21201367 TGTGCTCACCTCTCACCAGGAGG - Intergenic
1181312277 22:21951975-21951997 CCAGCTGAGCTCTCACCACGGGG - Intronic
1181401878 22:22654461-22654483 TGTGCTCACCTCTCACCAGGAGG + Intergenic
1181647674 22:24242641-24242663 TGTGCTCACCTCTCACCAGGAGG - Intronic
1181703832 22:24635555-24635577 TGTGCTCACCTCTCACCAGGAGG + Intergenic
1182979689 22:34657257-34657279 TGGGCTGAGCTTTTATCTGGAGG + Intergenic
1183418309 22:37695579-37695601 TGGCCTGAGCTCTCCCCAGGGGG + Intronic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1184355615 22:43977529-43977551 TCAGCTGACCTTTCACAATGTGG - Intronic
1185350715 22:50335861-50335883 AGAGATGAGGTTTCACCATGTGG + Intergenic
1203228938 22_KI270731v1_random:93490-93512 TGTGCTCACCTCTCACCAGGAGG + Intergenic
952910259 3:38178661-38178683 AGAGATGAGGTTTCACCATGTGG + Intronic
955726285 3:61936432-61936454 TTAGCTTGGCTTTGACCAGGTGG + Intronic
955894004 3:63679740-63679762 TGAGGTGACCTTTCAGTAGGTGG - Intergenic
959000419 3:100957773-100957795 GGAGCTGAGCTGTGAGCAGGCGG - Intronic
960972706 3:123150990-123151012 TAAGCTGAGCTGTAACCTGGGGG - Intronic
962128455 3:132647649-132647671 TCACCTGAGCTGTCACCAAGGGG - Intronic
962419316 3:135214328-135214350 AGAGCTGAGCTGTCCCCAAGTGG - Intronic
965674563 3:171181025-171181047 TGAGATGAGGTTTCACTATGTGG + Intronic
965770412 3:172175989-172176011 TATGCTGAGCTTTCACCTGATGG - Intronic
968259342 3:197307190-197307212 TCAGCTCAGCTTTCAACAGGAGG + Intergenic
968572526 4:1349554-1349576 TCAGCTGTGCTATCAGCAGGCGG - Exonic
968630365 4:1647648-1647670 TGTGCTGTGCTTGCACCTGGCGG - Intronic
968793933 4:2689370-2689392 TGAGCTGAGCTCAGCCCAGGGGG - Intronic
975404982 4:73979163-73979185 TGACTTGAGCTTTTCCCAGGAGG + Intergenic
976278118 4:83299176-83299198 AGAGATGAGGTTTCACCATGTGG - Intronic
977555770 4:98486153-98486175 AGAGGAGAGGTTTCACCAGGGGG - Intronic
980817628 4:137968487-137968509 TGAACTGTGCTTTTATCAGGAGG + Intergenic
981301686 4:143193902-143193924 TGAGATGGGGTTTCACCAAGGGG - Intronic
983915717 4:173288639-173288661 AGTGCTGAGCTTTCACGTGGAGG + Intronic
985002285 4:185497589-185497611 GGAGCTGAGATCTCACCAAGAGG + Intergenic
987475943 5:18392678-18392700 TTATCTGAGCTGTCACCTGGAGG + Intergenic
988252525 5:28778375-28778397 TGAGCAGAGTTTTCTCCAGATGG - Intergenic
988484156 5:31654559-31654581 TGAGATGACCCTTCAGCAGGAGG - Intronic
990023507 5:51158150-51158172 TGAGCTCTTCTTTCAACAGGAGG + Intergenic
991479211 5:67059040-67059062 TGAGCTGGGCTCTTACCTGGAGG + Intronic
992876173 5:81058158-81058180 TGAGTTATGCTTTCACCAAGTGG + Intronic
993983449 5:94569622-94569644 TGAGCCGAGGTTTCATCATGTGG - Intronic
994068594 5:95572310-95572332 TCAGATGAGCTTTCACTAGATGG + Intronic
995345813 5:111116133-111116155 GGAGCTGGGGTTTCACCATGTGG + Intronic
997364402 5:133316512-133316534 TGAACAGAGATTCCACCAGGAGG + Exonic
997600681 5:135136343-135136365 GGAGCTGAGCTTGAATCAGGTGG - Intronic
1001962885 5:175890930-175890952 TGAGCTGTGATTGCACCATGGGG - Intergenic
1003751762 6:9066621-9066643 AGAGATGAGGTTTCACCATGTGG + Intergenic
1004184569 6:13411006-13411028 AAACCTGAGCTTTCACCAGGAGG + Intronic
1004594237 6:17084194-17084216 AGAGATGAGGTTTCCCCAGGTGG + Intergenic
1005091264 6:22059337-22059359 TGGGCTGAGCTTTGAACAGCTGG + Intergenic
1006115799 6:31775599-31775621 AGAGCAGAGCTTTGCCCAGGTGG + Intronic
1007455403 6:41973272-41973294 TGAGCTGAACTTTCAGAAGCTGG - Intronic
1008662200 6:53679748-53679770 TGGGTTGAGCTTGCACCACGGGG + Intergenic
1009970523 6:70620712-70620734 TCATCTGAGCTTTCAGCAAGTGG - Intergenic
1010408422 6:75532887-75532909 TGAGCTGAGATTTCAGCTGCTGG + Intergenic
1011172749 6:84524092-84524114 TGTCCTGACCTTTCACTAGGTGG + Intergenic
1013398997 6:109772951-109772973 TGACCTGGGCTTTTACCTGGAGG + Intronic
1013851859 6:114525770-114525792 TGAGCTGAGCTCCCACAAGTGGG - Intergenic
1016210288 6:141524054-141524076 AGAGCTGAGCCTTCATCAGTGGG + Intergenic
1017290673 6:152731932-152731954 AGAGATGAGGTTTCACCATGTGG + Intergenic
1017814272 6:158005534-158005556 AGGGCTGAGGTTTCACCAGGTGG - Intronic
1017915307 6:158826935-158826957 TGAGATGGGATTTCACCATGTGG + Intergenic
1018623143 6:165751051-165751073 TGAGCTGTGCTGTCTCCTGGGGG + Intronic
1019204156 6:170344909-170344931 TGAGCTGAGATTTGAAGAGGGGG - Intronic
1019481575 7:1269496-1269518 TGAGCTGAACTTGCGGCAGGAGG - Intergenic
1019810439 7:3161451-3161473 AGAGGTGAGGTTTCACCATGTGG + Intronic
1023015808 7:35968177-35968199 TGAGCAGCTCGTTCACCAGGCGG - Intergenic
1023379718 7:39594779-39594801 AGAGATGGGCTTTCACCATGTGG + Intronic
1023457314 7:40354430-40354452 TGACCACAGCTTTAACCAGGTGG - Intronic
1023679748 7:42673537-42673559 TGAGCTGTGTTTTCACCTGGAGG + Intergenic
1023964518 7:44955993-44956015 TGTGCTGAGCTCTCAGCAGGAGG - Intergenic
1024008373 7:45244202-45244224 TGACCTGACCATTCACCTGGAGG + Intergenic
1024355223 7:48407609-48407631 TGAGCTGAGATTGCACCATTGGG - Intronic
1025244284 7:57304578-57304600 TGAGCTAAGCTTTCAAGAAGCGG - Intergenic
1025868278 7:65406246-65406268 TAAGATTAGCTTCCACCAGGAGG - Intergenic
1026945259 7:74312192-74312214 TGAGCTGAGATTGCACCACCTGG + Intronic
1028010850 7:85641888-85641910 TGTGCTGAGTTTTCATCTGGAGG - Intergenic
1029498326 7:100910820-100910842 AGAGATGAGGTTTCACCATGTGG + Intergenic
1031141595 7:117948948-117948970 TCAGCTGTGCCTTCAGCAGGAGG - Intergenic
1031827050 7:126578476-126578498 TGAGCTGTGCATTTGCCAGGTGG + Intronic
1033293215 7:140106803-140106825 TGAACTCAGCTTGCACCAAGTGG - Intronic
1034530405 7:151692952-151692974 TGAGCACAGCTGTCTCCAGGAGG - Intronic
1035479886 7:159173270-159173292 AGATCTGAGCTGTCAGCAGGTGG + Intergenic
1035939979 8:3888559-3888581 TTAGCTCAGCTTTCTCCAGCTGG - Intronic
1036018696 8:4816656-4816678 TCTGATGAGCTTTCACCAGTGGG - Intronic
1036134087 8:6142864-6142886 TGAGCTGAGATTGCACCACTGGG + Intergenic
1036466174 8:8999532-8999554 AGAGATGAGGTTTCACCATGTGG + Intergenic
1037292954 8:17370463-17370485 TGAGCTGAGATTGCACCAGGAGG + Intronic
1037902668 8:22696745-22696767 TGAGCTGAGCCCTCAACAGCTGG + Intergenic
1045395419 8:101756018-101756040 TGTGCTGAGCTGTCATCAGACGG + Intronic
1046193231 8:110826936-110826958 AGAGATGAGGTTTCACCATGTGG + Intergenic
1046729669 8:117711596-117711618 AGAGCAGAGCTTTCTCCAGCTGG - Intergenic
1048862412 8:138733690-138733712 TGAGCTGAGCTTTGGAGAGGAGG - Intronic
1049206267 8:141365101-141365123 TGCCCGGAGCCTTCACCAGGTGG - Intronic
1050023871 9:1312871-1312893 TTAGCTGATCTTTTACCAGAAGG + Intergenic
1050354308 9:4768923-4768945 TGGGCTGACCCTTCACCATGAGG - Intergenic
1051342921 9:16128237-16128259 TGAGCTGAGCTGGAACCAGGTGG - Intergenic
1052585643 9:30424753-30424775 TGAGCTGGGCTCTGAGCAGGCGG + Intergenic
1053005117 9:34599168-34599190 AGAGCTGAGCTGTCAACAGCAGG - Intergenic
1053453726 9:38214683-38214705 TGAGCTGAACCCTCACCAAGTGG + Intergenic
1056408702 9:86302792-86302814 AGAGATGAGGTTTCACCATGTGG + Intronic
1057279323 9:93698684-93698706 CTGGCTGAGCTCTCACCAGGGGG + Intergenic
1057450025 9:95149996-95150018 TGAGGAGAGCCTCCACCAGGGGG + Exonic
1057862521 9:98652754-98652776 TGAGAAGAGCTGGCACCAGGTGG + Intronic
1060169634 9:121450959-121450981 TGATCTGAGCTTTGCCAAGGTGG - Intergenic
1060819212 9:126651803-126651825 TGAGCTGGGAGTTCAACAGGCGG + Intronic
1060911233 9:127352742-127352764 GGAGCAGAGCTTTCACCATCAGG - Intronic
1061173477 9:128976753-128976775 TGACCTGACCTTACACCTGGAGG + Intronic
1061265093 9:129500292-129500314 TGAGCTGTGCTTTCACATTGGGG + Intergenic
1061984953 9:134125342-134125364 TGCGCTGAGCTCTCAGCAGAGGG - Intergenic
1062271322 9:135710962-135710984 TGAGCAGGGCTTTCTCCCGGTGG + Intronic
1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG + Exonic
1186064747 X:5750686-5750708 TGAGCTGAGATTGCACCACTGGG + Intergenic
1186113712 X:6282932-6282954 TGGGCTGAGCTCTCACCTGGAGG + Intergenic
1186435124 X:9536435-9536457 AGAGATGAGGTTTCACCATGTGG + Intronic
1187540285 X:20186645-20186667 TGAGCTGAGATTGCACCACTGGG - Intronic
1188836121 X:34956149-34956171 TGAGCCGAGATAGCACCAGGAGG + Intergenic
1192839068 X:74835631-74835653 TGAGCTGAGCTGTCTGGAGGTGG + Intronic
1193186081 X:78514423-78514445 TGAGCTAAGCTGTCACCTTGAGG - Intergenic
1193905773 X:87242857-87242879 TGAGCTGGGCCTTCACCACTGGG + Intergenic
1195712944 X:107789509-107789531 GGAGCTGAGTTTTTAACAGGAGG - Intronic
1197355873 X:125437042-125437064 TGATATTAGCTTCCACCAGGGGG + Intergenic
1200077193 X:153557029-153557051 TGAGCTGGGCGGGCACCAGGTGG - Intronic
1201280427 Y:12337646-12337668 AGAGATGAGGTTTCACCATGTGG - Intergenic